Logout succeed
Logout succeed. See you again!

Transcription regulation of ANG and RNASE4 locus 1 Transcription of angiogenin and ... PDF
Preview Transcription regulation of ANG and RNASE4 locus 1 Transcription of angiogenin and ...
JBC Papers in Press. Published on March 21, 2014 as Manuscript M114.551762 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M114.551762 Transcription regulation of ANG and RNASE4 locus Transcription of angiogenin and ribonuclease 4 is regulated by RNA Polymerase III elements and a CCCTC-binding factor (CTCF)-dependent intragenic chromatin loop* *Running title: Transcription regulation of ANG and RNASE4 locus Jinghao Sheng1,2, Chi Luo1, Yuxiang Jiang1, Philip W. Hinds1, Zhengping Xu2,3, Guo-fu Hu1,3 1Molecular Oncology Research Institute, Tufts Medical Center, 800 Washington Street, Boston, MA 02111, USA 2Institute of Environmental Medicine, Zhejiang University School of Medicine, 866 Yuhangtang Road, Hangzhou 310058, China 3To whom correspondence should be addressed: Guo-fu Hu, Molecular Oncology Research Institute, Tufts Medical Center, Boston, MA 02111. Tel: +1 6176364776; Fax: +1 6176369230; Email, [email protected]; Zhengping Xu, Institute of Environmental Medicine, Zhejiang University School of Medicine, Hangzhou, China. Tel: +86 57188208008; Fax +86 57188208163; Email, [email protected] D o Keywords: Ribonuclease, transcription, promoters, chromatin, RNA polymerase wn lo a d e Bshaacrke ggreonuentidc :r eAgniogniosg wenitihn parnodm roibteorn uacctlievaisteie 4s and pinrtorvaigdeen ice vcidhernocmea tifno r lotohpe bpertweseeennc e thoef twano d from both have growth and survival activity. CTCF binding sites located in two introns http Results: RNA polymerase III elements and flanking the ANG coding exon. We found that ://w w CTCF-dependent intragenic chromatin loop formation of this intragenic loop preferentially w regulates the transcription. enhances ANG transcription. These results .jb c .o Conclusion: Multiple layers of transcription suggest a multilayer transcriptional regulation rg regulation of this gene locus that encode two of ANG and RNASE4 gene locus. These data by/ g functionally similar but distinctive proteins. also add more direct evidence to the notion that u e s Significance: Elucidating how angiogenin and Pol III elements are able to directly influence t o n ribonuclease 4 are differentially transcribed help Pol II gene transcription. Furthermore, our Ja n understand their biological activities. data indicate that a CTCF-dependent ua ry chromatin loop is able to differentially regulate 6 , 2 ABSTRACT transcription of genes that share the same 0 1 9 Angiogenin (ANG) and ribonuclease 4 promoters. (RNASE4), two members of the secreted and vertebrate-specific ribonuclease superfamily, ANG, the fifth member of the secreted and play important roles in cancers and vertebrate-specific ribonuclease superfamily (1), is neurodegenerative diseases. The ANG and known to regulate angiogenesis and neurogenesis RNASE4 genes share genetic regions with during development (2). It also plays important promoter activities but the structure and roles in a number of pathological conditions regulation of these putative promotes are including cancers and neurodegenerative diseases unknown. We have characterized the promoter by modulating cell growth and survival properties regions, defined the transcription start site, and (3). ANG expression is upregulated in various identified a mechanism of transcription types of human cancers (4) where it has been regulation that involves both RNA polymerase shown to promote cancer progression (5) by III (Pol III) elements and CCCTC-binding stimulating both tumor angiogenesis (6) and factor (CTCF) sites. We found that two Pol III cancer cell growth (7). Thus, ANG inhibitors are elements within the promoter region influence perceived to have the benefit of combining anti- ANG and RNASE4 expression in a position- and angiogenesis therapy and chemotherapy as they orientation-dependent manner. We also 1 Copyright 2014 by The American Society for Biochemistry and Molecular Biology, Inc. Transcription regulation of ANG and RNASE4 locus will inhibit both cancer cell proliferation and locus has a similar arrangement to the mouse angiogenesis (8). counterpart (23). Transcripts of both ANG and RNASE4 having the same 5’UTR that contains In contrast to being upregulated in cancers, either exon I or exon II, but not both, have been ANG is down-regulated in amyotrophic lateral identified (23,27). These data suggest that human sclerosis (ALS) (9), Parkinson’s disease (PD) (10) ANG and RNASE4 share the same genetic regions and Alzheimer’s disease (11). More importantly, with promoter activities and are co-regulated loss-of-function mutations have been found in (23,25). In an attempt to understand the molecular patients with ALS and PD (12-14), suggesting that mechanism by which ANG and RNASE4 ANG plays a role in neuron survival and its transcription is regulated, we used bioinformatics deficiency is a risk factor of neurodegenerative analyses of the data sets released from the diseases (3). ANG has recently been shown to Encyclopedia of DNA Elements (ENCODE) mediate the production of tRNA-derived stress- project to discover functional elements in the ANG induced RNA (tiRNA) (15-18), which suppress and RNASE4 locus. These in silico-discovered global protein translation (17). However, internal elements were then verified and defined ribosome entry sequence (IRES)-mediated experimentally by means of luciferase reporter, translation with weak eIF4G binding (19), a RNAi knockdown, and chromatin conformation mechanism often used by anti-apoptosis and pro- capture (3-C) assays. This combined bioinformatic D o survival genes, is not inhibited by tiRNA (17). and experimental approach revealed a unique wn Therefore, tiRNA reprogram protein translation in mechanism of transcriptional regulation at the loa d r(e2s0p)o. nsAeN tGo -smtreedssia ttheedr ebtiyR NprAo mportiondgu ccteiloln s uirsv ivaanl tArNanGsc arnipdt iRonNaAl SaEc4ti vloitcyu so. fO tuhre d AatNa Gin daincdat eR tNhAatS tEh4e ed from important stress-response mechanism used by cells promoter is influenced by RNA polymerase III http when they are subjected to adverse environments (Pol III) elements and could be differentially ://w (21). regulated by an intragenic CCCTC binding factor ww RNASE4, the fourth member of the (CTCF)-dependent chromatin loop. .jb c superfamily, was originally co-isolated with ANG .o rg from tumor conditioned medium (22). It has EXPERIMENTAL PROCEDURES b/ y recently been shown that RNASE4 also possesses Data sets and in Silico analyses - Human genome g u e angiogenic, neurogenic, and neuroprotective sequence (Human species genomic assembly st o n activity (23). Moreover, a single nucleotide version, GRCh37/hg19) was downloaded from J a n polymorphism (SNP) has been shown to be UCSC (http://genome.ucsc.edu/). The chromatin u a associated in ALS patients (23) and supplementary states were characterized by ChromHMM ry 6 therapy with recombinant RNASE4 protein is software v1.06 , 2 0 1 beneficial to ALS model mice (23) as is ANG (24). (http://compbio.mit.edu/ChromHMM/) and 9 annotated on UCSC human genome track. TSS These early results underscore the data were collected from different available importance of understanding the regulatory resources by extracting full length cDNA mechanisms of ANG and RNASE4 transcription so sequences or deep CAGE tag data (DBTSS, that their expression and/or activity can be FANTOM3, FANTOM4) and analyzed by potentially manipulated for therapeutic Genomatix software suite (www.genomatix.de). applications in both cancers and (TFs were extracted from ENCODE data sets neurodegenerative diseases. Mouse Ang1 and using Genomatix software suite. Function Rnase4 genes have been reported to contain two annotations of the putative TF were carried out non-coding exons followed by two distinct exons with DAVID software encoding Ang1 and Rnase4, respectively (25). The (http://david.abcc.ncifcrf.gov/). two non-coding exons are preceded by two Promoter constructs - A 2 kb DNA promoters that control liver-specific and tissue- fragment of human chromosome 14 from position specific expression. As a consequence of this 21,150,940 to 21,152,939 was amplified by PCR unique gene structure, RNASE4 and ANG are often from LNCaP genomic DNA and cloned into the co-expressed (26). Human ANG and RNASE4 BglII and HindIII site of pGL3-B. The primer 2 Transcription regulation of ANG and RNASE4 locus sequences were: F 5'- encoding ANG and RNASE4 shRNA were GAAGATCTGGAAGAGCCGAGATTGGGAGG purchased from Open Biosystems. The sequences G-3', R 5'- of the two ANG shRNA used in this study are: E4, CCCAAGCTTAGGAGCAGGAGTGTGAACCT 5’-ATGTTTGACAACATGTTTAATA-3’; E7, 5’- ACC-3'. This fragment corresponds to positions - CAACGTTGTTGTTGCTTGTGAA-3’. That for 1396 to +604 in relevance of the TSS (position 1). RNASE4 are: D10, 5’- Serial deletion constructs were prepared by PCR CCCTAGTAAGTCAAAGTACTA-3’; M2, 5’- using the full length construct as the template. All CACCACCAATATCCAATGCAA-3’. The constructs were sequence confirmed. shRNA for CTCF (5′- Cell culture, transfection and reporter GGACAGTGTTGACAACTAA-3′ and 5′- assays – Prostate cancer cell lines (LNCaP, PC-3 GGTGCAATTGAGAACATTA-3′) were gifts and DU145) were maintained in RPMI 1640 from Dr. Joaquin M. Espinosa of University of medium + 10% FBS. U87MG Glioblastoma and Colorado (28). Lentiviral particles were packaged human embryonic kidney 293T cells were in 293T cells with the generation II packaging maintained in DMEM + 10% FBS. Transfections plasmids (psPAX2 and pMD2.G). Cells were were carried out in the presence of lipofectamine® infected with lentiviral particles for 24 h in the 2000 in 70% confluent cells. pRL-TK plasmid presence of polybrene (8 μg/mL, Millipore). The expressing Renilla luciferase (0.016 μg) was co- medium was replaced with complete growth D o transfected as an internal control for transfection medium and incubated for 24 h and then selected wn lo efficiency with various target constructs for 4 days with 1μg/mL puromycin. a d e eaxctpirveitsiseisn gw efirree fmlye alusucrifeedr absye t(h0e. 8D μugal)-.L Lucuicfiefrearsaes®e using TRRITz-oPl CreRa g-e Tnot taanl dc erellvuelarsre R tNraAns wcraibs eidso (l1a tμedg) d from Reporter Assay 24 h after transfection. The firefly to cDNA with random and Oligo(dT)18 primers http luciferase activity was normalized to the Renilla by M-MLV reverse transcriptase. cDNAs were ://w w luciferase in each sample. The promoter activity of amplified and quantified in DNA Engine Opticon w each construct was normalized to that of the 2. The primers set are as follows. ANG: F 5'- .jb c .o control plasmid pGL3-B. GTTGGAAGAGATGGTGATGG-3'; R 5'- rg Chromatin immuneprecipitation (ChIP) - CATAGTGCTGGGTCAGGAAG-3'. RNASE4: F b/ y g Cells were cross-linked with 1% formaldehyde for 5'- AGAAGCGGGTGAGAAACAA-3'; R 5'- u e s 10 min at 37 °C, and quenched with 0.125 M AGTAGCGATCACTGCCACCT-3'. CTCF: F 5'- t o n glycine. Cell pellets were collected and CAGTGGAGAATTGGTTCGGCA-3'; R 5'- J a n resuspended in ChIP lysis buffer (50 mM Tris, pH CTGGCGTAATCGCACATGGA-3'. GAPDH: F ua ry 8.1, 1% SDS, 10 mM EDTA). After sonication to 5'- TGAACGGGAAGCTCACTGG-3'; R 5'- 6 , 2 generate DNA fragments of 300 to 1000 bp, the TCCACCACCCTGTTGCTGTA-3'. 0 1 9 lysates were cleared by centrifugation, diluted Chromosome Conformation Capture (3C) tenfold with ChIP dilution buffer (16.7 mM Tris, -A total of 1x107 cells were trypsinized and re- pH 8.1, 0.01% SDS, 1.1% Triton X-100, 1.2 mM suspended in 10 ml medium and cross-linked with EDTA, 16.7 mM NaCl). After pre-clearing with 2% formaldehyde for 10 m at RT. Crosslinking salmon sperm DNA/protein G-agarose at 4 °C for was quenched by 0.125 M glycine. After washing 1 h, the samples were incubated with 5 μg of with cold PBS, cells were lysed in 3C lysis buffer CTCF IgG or control non-immune IgG overnight (10 mM Tris, pH 8.0, 10 mM NaCl, 0.2% NP-40) at 4°C. The immuno-complexes were collected for 10 m on ice. Nuclei were pelleted by with protein-G agarose, eluted, and de-crosslinked centrifugation at 1,800 rpm for 5 m at 4°C and re- at 65°C. After incubation with RNase A and suspended with 1.2 x restriction enzyme buffer proteinase K, DNA was extracted and examined containing 0.3% SDS. After 1 h incubation at by qPCR with the primers for site A (F 5'- 37 °C, Triton X-100 was added to 2 % and ACAGCATTGGCACCTCCTGCAA-3', R 5'- incubated for 1 h at 37 °C. Chromatin was then TGCCTGGTGCCAGAATCCCAG -3') and site B digested by 400 U StuI overnight at 37 °C. (F 5'-TCAAGACTGGAGGTGGACTCAC-3', R Digestion was stopped by the addition of SDS to 5'-TCAAGACTGGAGGTGGACTCAC-3'). 1.6% followed by heated inactivation at 65°C for RNAi - Lentiviral particles vectors (GIPZ) 20 m. The digested chromatin was diluted to 6.125 3 Transcription regulation of ANG and RNASE4 locus ml by 1.15 x 3C ligation buffer (660 mM Tris, pH 21,166,089, respectively (Fig. 1A). It is notable 7.5, 50 mM MgCl , 10 mM DTT, and 1 mM ATP). that the two insulators are located in the two 2 Triton X-100 was then added to a final introns flanking the ANG coding exon. concentration of 1% and incubated for 1 h at 37 °C Bioinformatics analysis of the with gentle shaking. The chromatin was then transcription start site (TSS) - We next used the ligated by incubating with 2,000 U of T4 DNA Genomatix software suite ligase overnight at 16 °C. After overnight (http://www.genomatix.de) to predict TSS of ANG incubation with 10 μg/ml proteinase K at 65 °C to and RNASE4 genes from cap-analysis of gene reverse the crosslinks, ligated DNA was extracted expression (CAGE) databases. A total of 113 and examined by PCR. The sequences of primers CAGE tags were identified across the entire gene are as follows: 1R 5'- locus, clustered in two regions (Fig. 1B). Seven ACCCACGTGATCGTGGATGAAC-3', 2F 5'- tags were located at position 21,156,940 before AGAAAGAGAGCCCACTTTGCTCACC-3'; 4F exon II, which occur only in liver cells indicating a 5'-GCTGTGATTGTTGGCTTTGCAAGG-3'; 4R liver-specific promoter (Promoter-L) at this 5'-GACACCGTGGTCTAAAAGACTGAGG-3'; region. In a 700 bp region from 21,152,300 to 5F 5'- GGAGTGACGGCCAGATGGCA-3'. 21,153,000 that covers exon I and the flanking regions, we identified a total of 106 tags at 44 different positions from all tissue types including D o liver, intestine, cecum, colon, lung, kidney, frontal wn RESULTS lo lobe, heart, adipose and embryo. We therefore a d Chromatin state segmentation of ANG and e RNASE4 gene locus - The human ANG and nuanmiveedrs athl isp rroemgiootne rP. rAommootnegr- Uth e(P 1r-0U6) CinAdGicEat itnagg sa, d from R14NqA1S1E.24 angde nheasv e aar eu nilqoucea taerdr anogne mechnrt oimn owsohimche 2id1e noticfcieudr aa t CppoGsi tiisolnan d2 1f,r1o5m2 ,7p7o6si. tiWone 2h1a,1v5e2 ,a4l8s4o http://w they share the same promoter regions and 5'-UTR w to 21,152,740. These data suggest that ANG and w followed by two distinct exons encoding the two RNASE4 belong to a gene class with a "broad" .jb c proteins (23,25). Promoter sharing is one of the .o TSS (31) that can initiate transcription in a broader rg four known co-regulatory mechanisms that ensure region. b/ y multiple genes with similar activities or involved g Putative TFs on Pr-U of ANG and u e in the same pathways are co-regulated. Among the s RNASE4 gene locus - In silico analyses using the t o 24 known gene pairs that share the same n Genomatix software suite revealed a total of 26 J a promoters in the human genome (29), ANG and n TFs that could potentially bind to Pr-U of the ANG ua RNASE4 have the highest coefficiency (r=0.77) of ry and RNASE4 gene (Table 1). Significantly, 8 of 6 co-expression (29), indicating that they have a , 2 them belong to the nuclear receptor superfamily. A 0 similar biological activity. Indeed, we have found 19 more detailed analysis on TFs was carried out with that besides the ribonucleolytic activities, ANG data available from the ENCODE project. Cscan and RNASE4 both have angiogenic, neurogenic, analyses (32) identified 63 putative TFs. Among and neuroprotective activities (23). In order to these, 6 belong to the nuclear receptor superfamily understand the regulatory mechanisms of ANG and (Table 1). Preferential enrichment of the nuclear RNASE4 expression, we employed ChromHMM, a receptor class of TFs on ANG and RNASE4 chromatin-state discovery and characterization promoter is consistent with known functions of software (http://compbio.mit.edu/ChromHMM/), ANG in hormone-regulated prostate (5,33-35) and to reveal the chromatin state of the human ANG breast (36,37) cancer. and RNASE4 gene locus (chr14: 21,150,000- To reveal other potential biological 21,170,000, genome assembly version activities of ANG and RNASE4, we carried out GRCh37/hg19 (30)). We identified three pathway annotations by Database for Annotation, regulatory regions at this locus from data released Visualization, and Integrated Discovery (DAVID) by the ENCODE project: an active promoter bioinformatics tools region (red) from position 21,150,000 to (http://david.abcc.ncifcrf.gov/). Table 2 lists the 21,153,000, and two insulators (blue) from top 10 pathways identified from the Kyoto 21,159,364 to 12,159,383 and from 21,166,070 to Encyclopedia of Genes and Genomes (KEGG) (38) 4 Transcription regulation of ANG and RNASE4 locus and BioCarta (www.biocarta.com) databases. TFs the nature of these inhibitory elements, we re- that are enriched in the ANG and RNASE4 evaluated this region by bioinformatic analyses of promoter are related in pathways in cancer, the ENCODE project data and found that two particularly in prostate, pancreatic, thyroid, tRNA genes (tRNATyr and tRNApro), located at bladder, and non-small cell lung cancers, and in 21,151,432-21,151,520 and 21,152,175- chronic myeloid leukemia (Table 2). In addition, 21,152,246, respectively, were fully loaded with cell cycle and Huntington’s disease pathways are Pol III transcription machinery including Pol III, also significantly correlated. These findings are TFIIIB and TFIIIC (Fig. 4). They are therefore consistent with the roles of ANG and RNASE4 in referred to as Pol III elements. cancers and neurodegenerative diseases (3). The effect of these Pol III elements on Pol Characterizations of ANG and RNASE4 II transcription was examined by reporter assays promoters - A luciferase reporter assay system (Fig. 5A). Insertion of the tRNATyr element was used to confirm that Pr-U indeed has promoter downstream of Pr-1 in forward orientation activity and to define the minimum promoter decreased the promoter activity from 50.1 ± 7.9 in sequence. A 2kb region from positions 21,150,940 P-1 to 9.19 ± 1.99 in P-2 (p<0.0001). However, to 21,152,939, referred as 1 to 2,000 in luciferase insertion in reverse orientation at the same assays, was cloned into pGL3-B reporter vector position had no effect. The activity of P-3 is 42.3 and the promoter activity was examined in 5 cell ± 6.8, not significantly different from that of P-1 D o lines. Fig. 2A shows that this 2 kb fragment, which (p=0.26). Similarly, the tRNATyr element also wn lo was named Pr-U, has prominent activity in all 5 suppresses the activity of Pr-2. Construct P-5 has a d e caneldl liDneUs 1i4n5cl,u dginligo bplraosstotamtea cacneclel r clienlle linUe8s 7PMCG-3, adne craecatsive itfyr omof t5h.a6t o±f P0.-14, (r3e4p.r1e s±e n5ti.6n,g pa= 06.0-f0o2l)d. d from human embryonic kidney cells HEK293T, and Again, insertion in reverse orientation had no http hepatocellular carcinoma cells HepG2. However, effect on Pr-2. P-6 has an activity of 32.3 ± 4.6, ://w promoter-L (Pr-L) (from position 21,154,000 to which is the same as that of P-4 (p=0.67). tRNApro ww 21,156,000) has activity only in HepG2 cells. element, the 2nd Pol III element found in this .jb c .o We next made a series of deletion mutants region, also suppresses transcription as shown in rg of Pr-U and measured their reporter activities in P-7. Insertion of this element, together with Pr-2, b/ y g DU145 cells (Fig. 2B). For deletion constructs downstream of Pr-1, decreased the activity from u e s from the 5’ end, after an initial decrease of activity 50.1 ± 7.9 in P-1 to 31.6 ± 3.0 in P-7 (p=0.002). t o n (FU-1), deletions gradually increased activity (FU- The activity of P-7 was the same as that of P-4, J a n 1 to FU-6). The maximum activity was observed indicating that Pr-1 was completely suppressed by ua in FU-6. However, further deletion resulted in tRNApro. ry 6 activity loss as shown in constructs FU-7 to FU-9. Insertion of tRNATyr element upstream of , 20 1 9 Among the series of deletion constructs Pr-1 in forward orientation enhances the promoter proceeding from the 3’ end, no significant activity from 50.1 ± 7.9 in P-1 to 74.1 ± 12.0 in P- promoter activity was observed from FD-1 to FD- 8 (p=0.02) (Fig. 5B). P-9, which has tRNATyr 6. However, FD-7 that retains only 200 bp of the element inserted in reverse orientation upstream of 5’ sequence had the highest promoter activity Pr-1, had the same activity as that of P-1 (p=0.83), among all the constructs including the full length. indicating that the enhancer activity of tRNATyr The first 100 bp of the 5’ sequence (FD-8) also has element is orientation-dependent. However, when a significant promoter activity. Very similar we placed the tRNATyr element, in both forward results were obtained in PC-3 cells (Fig. 3). and reverse orientations, upstream of Pr-2 that RNA Pol III-occupied elements affect Pol already had the tRNAPro element, no further II promoter activity - These data indicate that two enhancement of transcription activity was promoters exist in Pr-U. The first (Pr-1) is located observed (P-10 and P-11 vs P-4). Fig. 2B has at 1-200 and the second (Pr-2) is located at 1,750- already shown that tRNAPro element enhances Pr-2 2,000. It is also obvious that inhibitory elements activity (FU-6 vs FU-7). Thus, it is clear that when exist between 201 and 1,200. We confirmed that these Pol III elements are located upstream of Pol internal sections between 201 and 1,432 have no II promoters in forward orientation, they enhance promoter activities (Fig. 2C). In order to identify Pol II transcription. Existence of multiple Pol III 5 Transcription regulation of ANG and RNASE4 locus elements does not amplify the enhancement CTCF binding sites on ANG and RNASE4 locus activity. Identical results were obtained in 3 other were both 85% identical to the consensus CTCF cell lines including PC-3 human prostate cancer binding sequence (45) (Fig. 7B). (Fig. 6A), 293T human embryonic kidney (Fig. ChIP was carried out to examine the 6B), and U87MG human glioblastoma (Fig. 6C) binding of CTCF to the two sites in control and cells. Taken together, these results indicate that CTCF knockdown cells. Lentivirus-mediated tRNATyr and tRNAPro elements located upstream shRNA constructs efficiently knocked down both of the ANG and RNASE4 promoter can affect Pol mRNA and protein of CTCF (Fig. 8A). ChIP II gene transcription in a position- and orientation- combined with normal PCR (Fig. 8B) and qPCR dependent manner. (Fig. 8C) show that binding of CTCF to both sites In order to know whether the observation diminished in CTCF knockdown cells, that Pol III elements interfere with Pol II demonstrating that CTCF is indeed bound at the transcription is applicable to other promoters, we two consensus sites located at the two introns examined the effect of tRNATyr element on SV40 flanking ANG coding exon. promoter activity. Figure 5C shows that insertion CTCF is known to mediate the formation of tRNATyr element in forward orientation of chromatin loops facilitating transcription downstream of the SV40 promoter decreases the regulation (40). We therefore examined such a activity to 37 ± 10% (P-13) of that of control (P- possibility in the ANG and RNASE4 locus by D o 12) (p<0.002). Insertion in reverse orientation (P- chromosome conformation capture (3C) analysis wn lo 14) had no significant effect (89 ± 2%, p=0.24). (46). Fig. 9A is a schematic view of dynamic a d e Ionrsieenrttiaotino nu pesntrheaanmc eodf aScVtiv4i0t yp rboym o2t.6er fionl df o(rPw-a1r5d, ssphaotwia lt hoer gparnimizeartsio nu seodf ftohri sP CreRg ioanm. pTlifhiec atairorno wins d from 259 ± 20%, p<0.0001) but had no significant this 3C experiment. Vertical lines mark the http effect if inserted in reverse orientation (P-16, 122 restriction enzyme StuI sites. If such a loop forms, ://w w ± 18%, p=0.14). These results confirmed the after crosslinking, StuI digestion and T4 ligation, w position- and orientation-dependent manner of Pol one would expect a PCR product to be produced .jb c .o III elements in either enhancing or inhibiting Pol II by primer sets 2F/4R and 5F/1R. However, primer rg activity. To our knowledge, this is the first sets 2F/1R and 5F/4R will generate amplicons b/ y g experimental report that Pol III elements regulate regardless of crosslinking as far as the products u e s transcription of Pol II genes. were ligated (self ligation). Fig. 9B shows that the t o n Formation of a CTCF-dependent 3C experiments generated the results exactly as we J a n chromatin loop between the two introns flanking expected, indicating an intragenic loop is indeed ua ry ANG coding exon - Another distinct feature of the formed between the two CTCF binding sites. The 6 , 2 ANG and RNASE4 gene locus is that there are two PCR products from primer sets 2F/4R and 5F/1R 0 1 9 insulators located in the introns flanking the ANG were recovered and the sequencing results coding exon (Fig. 1A). We have identified two confirmed the loop formation. CTCF binding sites within the two insulators by To confirm that formation of this CTCF chromatin immuneprecipitation (ChIP)-seq chromatin loop is CTCF-dependent, we carried out data from the ENCODE project in five cell lines a ChIP-3C experiment (Fig. 9C) in which (Fig. 7A). CTCF is a ubiquitously expressed and chromatin was precipitated by a non-immune or a highly conserved 11-zinc-finger protein and has CTCF-specific IgG. Immuno-precipitated been implicated in diverse cellular processes (39). chromatin was then subjected to 3C analysis. A CTCF has been shown to both positively and specific band was observed from CTCF-specific negatively regulate gene expression (40,41). It not immunoprecipitated chromatin (lane 2) but not only interacts with the initiation and elongation from control IgG immunoprecipitates (lane 1). We complex, but also affects transcript splicing (42,43) have also performed ChIP-3C experiments in thereby affecting overall transcription levels (44). CTCF knockdown cells (Fig. 9C, lanes 3 and 4). Moreover, CTCF has been recognized as a master As expected, the PCR products generated from organizer of genomic spatial structure by primer sets 2F/4R and 5F/1R were undetectable in mediating long-range chromosomal interactions CTCF knockdown cells. Taken together, these through looping (40). The sequences of the two results demonstrate that CTCF mediates the 6 Transcription regulation of ANG and RNASE4 locus formation of an intragenic chromatin loop between overexpression differentially regulates the level of the two introns flanking the coding exon of ANG ANG and RNASE4 mRNA could be through gene. pausing of the Pol II elongation complex, which CTCF influences the mRNA level of ANG has been shown in both mammalian cells (47) and and RNASE4 -We next examined the effect of yeast (48). An intragenic chromatin loop may CTCF level on the mRNA level of ANG and cause transcription pausing at the second CTCF RNASE4. Two shRNA constructs knocked down site thereby increasing the possibility of CTCF mRNA levels by 71 and 76%, respectively transcription re-initiation and/or alternative (Fig. 10A, left). Immunoblot analyses indicated a splicing in favor of the inclusion of ANG coding nearly-complete loss of CTCF protein in the exon in the transcript. If this hypothesis is true, knockdown cells (Fig. 10A, right). ANG mRNA there will be two transcripts: one contains only the levels in the shRNA1 and shRNA2-infected cells ANG coding exon and the other contains both were 55 ± 9 and 35 ± 10%, respectively, of that in ANG and RNASE4 exons. In this case, shRNA control cells (Fig. 10B). Similarly, the mRNA specific to ANG will knockdown both transcripts levels of RNASE4 in the two CTCF knockdown but that specific to RNASE4 will only knockdown cell lines were 62 ± 6 and 33 ± 4% of that in the transcript containing RNASE4 coding exon. control cells (Fig. 10B). ELISA analyses showed Fig. 11D shows that this was exactly the case. that secreted ANG protein level were 1.40 ± 0.25 ANG shRNAs knocked down both ANG and D o and 1.12 ± 0.23 pg/1,000 cells/day, respectively, in RNASE4, whereas RNASE4 shRNAs knockdown wn lo the two knockdown cell lines, which is only RNASE4. a d e s±i0g.n1i3fi cpagn/t1l,y0 0lo0w ceerl lst/hdaany )t h(aFti gin. 1c0oCn)tr. oTl hcee lplsr o(t1ei.9n DISCUSSION d from levels of RNASE4 in these cells are unknown as We found that the tRNATyr and tRNApro http an ELISA method is currently unavailable. genes located in the promoter region of the ANG ://w However, judging from the qPCR results, it is and RNAS4 gene locus influence the promoter ww clear that knockdown of CTCF decreased ANG activity in a reporter assay. Several genome-wide .jb c and RNASE4 transcript levels. Importantly, studies have shown that Pol II binds near many .org reporter gene expression promoted by ANG and known Pol III genes and influences the expression b/ y RNASE4 Pr-U was not affected by the cellular of Pol III genes (49-51). It has been reported that gu e CTCF level (Fig. 10D), indicating that the effect tRNA elements can act as insulators (52) and that st o n of CTCF on ANG and RNASE4 expression is gene- Pol III complexes can have extra-transcriptional J a n specific and is not a consequence of changes in function such as act as a potential global ua overall transcription capacity. chromatin bookmark to regulate gene expression ry 6 We have also examined the effect of patterns. We found that two Pol III genes (tRNATyr , 20 1 CTCF overexpression on the mRNA levels of and tRNApro) are located within the universal 9 ANG and RNASE4. Two overexpression vectors promoter of ANG and RNASE4 gene locus, and were used: one with a V5-His tag at the C- that both tRNA genes are actually occupied by Pol terminus and another with a Flag-HA tag at the N- III complex including Pol III, TFIIIB and TFIIIC. terminus. The expression vectors were transfected We further demonstrated that these fully occupied in DU145 cells and the transgene expression level Pol III-elements regulate Pol II gene transcription was examined by immunoblot analyses with anti- in a position- and orientation-dependent manner. His and anti-CTCF IgG (Fig. 11A). The mRNA When the Pol III elements are located downstream levels of ANG and RNASE4 were examined by of the Pol II promoter, they inhibit the promoter qRT-PCR (Fig. 11B). The results indicated that activity. However, when they are located upstream CTCF overexpression enhanced ANG expression of the Pol II promoter, they enhance the promoter by ~ 70% but had no effect on RNASE4 expression. activity. Both the enhancive and inhibitory Again, luciferase reporter gene expression activities require the Pol III elements to be in promoted by Pr-U was not affected (Fig. 11C), forward orientation. These results provide direct confirming that the overall transcription capacity experimental evidence that Pol III-occupied genes of the cells were not altered. could either suppress or enhance Pol II gene One possible mechanism by which CTCF expression. 7 Transcription regulation of ANG and RNASE4 locus The reason for transcription-enhancing loop facilitates transcription re-initiation, which activity of Pol III elements located upstream of Pol will result in exclusion of RNASE4 coding exon II promoter could be a result of increased from some of the transcripts. The observation that accessibility of Pol II components to the promoter. ANG shRNAs knockdown expression of both ANG It is conceivable that juxtaposition of active Pol III and RNASE4, whereas RNASE4 shRNAs transcription machinery with a Pol II promoter knockdown only RNASE4 supported this will create an open/active chromatin facilitating mechanism. Enhancement of ANG expression in binding of Pol II components. However, when a RNASE4 knockdown cells could be the result of a Pol III complex is formed downstream of a Pol II feedback effect that will selectively produce ANG promoter, it may serve as a physical barrier to mRNA based on the above proposed mode of prevent Pol II machinery from passing through the action. chromatin, thereby decreasing the overall We have thus determined the transcription transcription efficiency. initiation site of the ANG and RNASE4 genes, Another major finding of this study is that characterized the promoter sequences, and a CTCF-dependent intragenic chromatin loop identified putative TFs, and annotated potential formed between two introns and that this loop biological pathways where ANG and RNASE4 differentially regulates the transcription of ANG could play a role. We have characterized the and RNASE4. The ENCODE project has identified promoter activities and identified two potential D o tens of thousands of CTCF-binding sites in a large mechanisms that regulate ANG and RNASE4 wn lo number of human cell types, confirming on a expression. While the Pol III elements control the a d e ggeennoe maicct isvcaatlioe nt haant dC TreCpFre isss iaosns o(c3i9at)e. dC wTiCthF bhoaths greegnuelraatle AprNoGm oatnerd RacNtAivSitEy4 tehxapt reisnsdioisnc,r iam CinTaCteFly- d from been shown to interact with the initiation and dependent intragenic chromatin loop differentially http elongation complexes of Pol II and to affect regulates ANG and RNASE4 expression. These ://w w splicing (43). We identified two CTCF-binding results indicate that even though ANG and w sites in the two introns flanking the ANG coding RNASE4 share the same promoter regions, they are .jb c .o exon. Formation of such an inter-intron chromatin not entirely co-expressed, suggesting that they rg loop changes the chromatin structure of the ANG have similar but distinct biological functions (23). b/ y g and RNASE4 gene locus by looping out the ANG Indeed, both ANG and RNASE4 have been shown u e s coding exon from a linear chromatin structure. We to have angiogenic, neurogenic, and t o n found that overexpression of CTCF enhanced the neuroprotective activities and play an important J a n expression of only ANG but not RNASE4. These role in cancers and in neurodegenerative diseases. ua ry results revealed a new model of transcription But there are important differences in their 6 , 2 regulation by CTCF. We speculated that ribonucleolytic activities and substrate specificities. 0 1 9 overexpression of CTCF may result in formation For example, RNASE4 has at least 30,000-fold of an excessive loop with a rigid chromatin that higher ribonucleolytic activity than does ANG serves as a protein barrier causing transcription (22). Significantly, the K40A variant of RNASE4 pausing at the second CTCF-binding site. Paused in which the catalytically essential residue Lys40 transcription will alter the splicing of the transcript has been replaced by Ala actually has enhanced that preferentially favors the inclusion of the ANG angiogenic activity (23). Moreover, RNASE4 has coding exon because at this time the RNASE4 exon very strict substrate specificity. It strongly prefers has not yet been transcribed. It has been reported a uridine at the 3’-side of the cleavage site (22), that a single CTCF binding site overlapping exon whereas ANG recognize both uridines and 5 of the CD45 gene is associated with inclusion of pyrimidines. Differential regulation of ANG and exon 5 in CD45 transcripts by affecting alternative RNASE4 expression by the CTCF-dependent splicing (47). Another possible mechanism for intragenic chromatin loop is thus in keeping with differential expression of ANG and RNASE4 genes the subtle but distinct difference in the biological in CTCF overexpressing cells could be that activities of the two proteins. transcription pausing at the end of the chromatin 8 Transcription regulation of ANG and RNASE4 locus REFERENCES 1. Riordan, J. F. (2001) Angiogenin. Methods Enzymol 341, 263-273 2. Subramanian, V., and Feng, Y. (2007) A new role for angiogenin in neurite growth and pathfinding: implications for amyotrophic lateral sclerosis. Hum Mol Genet 16, 1445-1453 3. Li, S., and Hu, G. F. (2010) Angiogenin-mediated rRNA transcription in cancer and neurodegeneration. Int J Biochem Mol Biol 1, 26-35 4. Tello-Montoliu, A., Patel, J. V., and Lip, G. Y. (2006) Angiogenin: a review of the pathophysiology and potential clinical applications. J Thromb Haemost 4, 1864-1874 5. Yoshioka, N., Wang, L., Kishimoto, K., Tsuji, T., and Hu, G. F. (2006) A therapeutic target for prostate cancer based on angiogenin-stimulated angiogenesis and cancer cell proliferation. Proc Natl Acad Sci USA 103, 14519-14524 6. Kishimoto, K., Liu, S., Tsuji, T., Olson, K. A., and Hu, G. F. (2005) Endogenous angiogenin in endothelial cells is a general requirement for cell proliferation and angiogenesis. Oncogene 24, 445-456 7. Tsuji, T., Sun, Y., Kishimoto, K., Olson, K. A., Liu, S., Hirukawa, S., and Hu, G. F. (2005) Angiogenin is translocated to the nucleus of HeLa cells and is involved in ribosomal RNA transcription and cell proliferation. Cancer Res 65, 1352-1360 8. Li, S., Ibaragi, S., and Hu, G. F. (2011) Angiogenin as a molecular target for the treatment of D o prostate cancer. Curr Cancer Ther Rev 7, 83-90 wn lo 9. McLaughlin, R. L., Phukan, J., McCormack, W., Lynch, D. S., Greenway, M., Cronin, S., a d e SHaaurdnidmerasn, ,J O., .S (l2o0w1i0k), A A.,n Tgioomgeikn,i nB L., eAvneldse arsnedn A, PN. GM G., eBnroatdylpeeys, :D D. yGsr.,e Jgauklaetmioann ,i nP .A, manydo trophic d from Lateral Sclerosis. PLoS One 5, e15402 http 10. Steidinger, T. U., Standaert, D. G., and Yacoubian, T. A. (2011) A neuroprotective role for ://w w angiogenin in models of Parkinson's disease. J Neurochem 116, 334-341 w 11. Kim, Y. N., and Kim, D. H. (2012) Decreased serum angiogenin level in Alzheimer's disease. .jb c .o Prog. Neuropsychopharmacol. Bio.l Psychiatry 38, 116-120 rg 12. Greenway, M. J., Andersen, P. M., Russ, C., Ennis, S., Cashman, S., Donaghy, C., Patterson, V., b/ y g Swingler, R., Kieran, D., Prehn, J., Morrison, K. E., Green, A., Acharya, K. R., Brown, R. H., Jr., u e s and Hardiman, O. (2006) ANG mutations segregate with familial and 'sporadic' amyotrophic t o n lateral sclerosis. Nat Genet 38, 411-413 J a n 13. van Es, M. A., Schelhaas, H. J., van Vught, P. W., Ticozzi, N., Andersen, P. M., Groen, E. J., ua ry Schulte, C., Blauw, H. M., Koppers, M., Diekstra, F. P., Fumoto, K., LeClerc, A. L., Keagle, P., 6 , 2 Bloem, B. R., Scheffer, H., van Nuenen, B. F., van Blitterswijk, M., van Rheenen, W., Wills, A. 0 1 9 M., Lowe, P. P., Hu, G. F., Yu, W., Kishikawa, H., Wu, D., Folkerth, R. D., Mariani, C., Goldwurm, S., Pezzoli, G., Van Damme, P., Lemmens, R., Dahlberg, C., Birve, A., Fernandez- Santiago, R., Waibel, S., Klein, C., Weber, M., van der Kooi, A. J., de Visser, M., Verbaan, D., van Hilten, J. J., Heutink, P., Hennekam, E. A., Cuppen, E., Berg, D., Brown, R. H., Jr., Silani, V., Gasser, T., Ludolph, A. C., Robberecht, W., Ophoff, R. A., Veldink, J. H., Pasterkamp, R. J., de Bakker, P. I., Landers, J. E., van de Warrenburg, B. P., and van den Berg, L. H. (2011) Angiogenin variants in Parkinson disease and amyotrophic lateral sclerosis. Ann Neurol 70, 964- 973 14. Wu, D., Yu, W., Kishikawa, H., Folkerth, R. D., Iafrate, A. J., Shen, Y., Xin, W., Sims, K., and Hu, G. F. (2007) Angiogenin loss-of-function mutations in amyotrophic lateral sclerosis. Ann Neurol 62, 609-617 15. Emara, M. M., Ivanov, P., Hickman, T., Dawra, N., Tisdale, S., Kedersha, N., Hu, G. F., and Anderson, P. (2010) Angiogenin-induced tRNA-derived stress-induced RNAs promote stress- induced stress granule assembly. J. Biol. Chem. 285, 10959-10968 16. Fu, H., Feng, J., Liu, Q., Sun, F., Tie, Y., Zhu, J., Xing, R., Sun, Z., and Zheng, X. (2009) Stress induces tRNA cleavage by angiogenin in mammalian cells. FEBS Lett 583, 437-442 9 Transcription regulation of ANG and RNASE4 locus 17. Ivanov, P., Emara, M. M., Villen, J., Gygi, S. P., and Anderson, P. (2011) Angiogenin-Induced tRNA Fragments Inhibit Translation Initiation. Mol Cell 43, 613-623 18. Yamasaki, S., Ivanov, P., Hu, G. F., and Anderson, P. (2009) Angiogenin cleaves tRNA and promotes stress-induced translational repression. J Cell Biol 185, 35-42 19. Baird, S. D., Turcotte, M., Korneluk, R. G., and Holcik, M. (2006) Searching for IRES. RNA 12, 1755-1785 20. Thompson, D. M., Lu, C., Green, P. J., and Parker, R. (2008) tRNA cleavage is a conserved response to oxidative stress in eukaryotes. RNA 14, 2095-2103 21. Li, S., and Hu, G. F. (2012) Emerging role of angiogenin in stress response and cell survival under adverse conditions. J Cell Physiol 227, 2822-2826 22. Shapiro, R., Fett, J. W., Strydom, D. J., and Vallee, B. L. (1986) Isolation and characterization of a human colon carcinoma-secreted enzyme with pancreatic ribonuclease-like activity. Biochemistry 25, 7255-7264 23. Li, S., Sheng, J., Hu, J. K., Yu, W., Kishikawa, H., Hu, M. G., Shima, K., Wu, D., Xu, Z., Xin, W., Sims, K. B., Landers, J. E., Brown, R. H., Jr., and Hu, G. F. (2013) Ribonuclease 4 protects neuron degeneration by promoting angiogenesis, neurogenesis, and neuronal survival under stress. Angiogenesis 16, 387-404 24. Kieran, D., Sebastia, J., Greenway, M. J., King, M. A., Connaughton, D., Concannon, C. G., D o Fenner, B., Hardiman, O., and Prehn, J. H. (2008) Control of motoneuron survival by wn lo angiogenin. J Neurosci 28, 14056-14061 a d e 25. dDuyaelr p, rKo.m Do.t,e arsn dfo Rr otissesnubee-srgp,e cHif. iFc .e (x2p0r0e5s)s i oTnh. eN mucoluesice ARcNidass eR 4e sa.n 3d3 R, 1N0a7s7e- 150/a8n6g 1 locus utilizes d from 26. Futami, J., Tsushima, Y., Murato, Y., Tada, H., Sasaki, J., Seno, M., and Yamada, H. (1997) http Tissue-specific expression of pancreatic-type RNases and RNase inhibitor in humans. DNA Cell ://w w Biol 16, 413-419 w 27. Strydom, D. J. (1998) The angiogenins. Cell Mol Life Sci 54, 811-824 .jb c .o 28. Gomes, N. P., and Espinosa, J. M. (2010) Gene-specific repression of the p53 target gene PUMA rg via intragenic CTCF-Cohesin binding. Genes Dev 24, 1022-1034 b/ y g 29. Yang, W., Ng, P., Zhao, M., Wong, T. K., Yiu, S. M., and Lau, Y. L. (2008) Promoter-sharing u e s by different genes in human genome--CPNE1 and RBM12 gene pair as an example. BMC t o n Genomics 9, 456 J a n 30. Ernst, J., Kheradpour, P., Mikkelsen, T. S., Shoresh, N., Ward, L. D., Epstein, C. B., Zhang, X., ua ry Wang, L., Issner, R., Coyne, M., Ku, M., Durham, T., Kellis, M., and Bernstein, B. E. (2011) 6 , 2 Mapping and analysis of chromatin state dynamics in nine human cell types. Nature 473, 43-49 0 1 9 31. Sandelin, A., Carninci, P., Lenhard, B., Ponjavic, J., Hayashizaki, Y., and Hume, D. A. (2007) Mammalian RNA polymerase II core promoters: insights from genome-wide studies. Nat Rev Genet 8, 424-436 32. Zambelli, F., Prazzoli, G. M., Pesole, G., and Pavesi, G. (2012) Cscan: finding common regulators of a set of genes by using a collection of genome-wide ChIP-seq datasets. Nucleic Acids Res 33. Ibaragi, S., Yoshioka, N., Kishikawa, H., Hu, J. K., Sadow, P. M., Li, M., and Hu, G.-f. (2009) Angiogenin-stimulated Ribosomal RNA Transcription Is Essential for Initiation and Survival of AKT-induced Prostate Intraepithelial Neoplasia. Mol Cancer Res 7, 415-424 34. Ibaragi, S., Yoshioka, N., Li, S., Hu, M. G., Hirukawa, S., Sadow, P. M., and Hu, G.-f. (2009) Neamine inhibits prostate cancer growth by suppressing angiogenin-mediated ribosomal RNA transcription. Clin Cancer Res 15, 1981-1988 35. Katona, T. M., Neubauer, B. L., Iversen, P. W., Zhang, S., Baldridge, L. A., and Cheng, L. (2005) Elevated expression of angiogenin in prostate cancer and its precursors. Clin Cancer Res 11, 8358-8363 10