loading

Logout succeed

Logout succeed. See you again!

ebook img

The Peptide pQFYRFamide Is Encoded on the FMRFamide Precursor of the Snail Helix aspersa but Does Not Activate the FMRFamide-Gated Sodium Current PDF

pages12 Pages
release year1996
file size4.8 MB
languageEnglish

Preview The Peptide pQFYRFamide Is Encoded on the FMRFamide Precursor of the Snail Helix aspersa but Does Not Activate the FMRFamide-Gated Sodium Current

Reference: Biol. Bull. 191:341-351.(December, 1946) The Peptide pQFYRFamide Is Encoded on the FMRFamide Precursor of the Snail Helix aspersa but Does Not Activate the FMRFamide-Gated Sodium Current T.DD.. AL.EEP2R,IEC.EM1,.KL.UE.TZD3O, BJ.LESO1,MWM.ERLVESISLELRE1,3,MS.. JF. AGLRCEOENNEBRE3R, GAN1,DK.GM..A.SWCIOTDTERREELKL2', 3 1WhitneyLaboratory, St. Augustine, Florida32086-8623:2CityofHope. BeckmanResearch Institute, Duarte. California:and^SchoolofBiologyandMedicalScience, UniversityofSt. Andrews, KYI69TS. Scotland, UnitedKingdom Abstract. The complete sequence ofthe FMRFamide scribed from an opisthobranch, Aplysia californica precursor cDNA from Helix aspersa is reported here. (Schaefer et al., 1985; Taussig and Scheller, 1986), and Since the 5' end ofthis cDNA is identical to that ofthe a pulmonate, Lymnaea stagnalis (Linacre et al., 1990). precursor that encodes the heptapeptide analogs of Althoughonlyafewstretchesofaminoacidsequenceare FLRFamide, the two transcripts are probably derived common to the precursors of these two species [i.e., a by alternative RNA splicing. A novel pentapeptide, singlecopyofFLRFamide,asequenceSEEPLYRKRRS Glp-Phe-Tyr-Arg-Phe-NH2 (pQFYRFamide), predicted which includes a tetrabasic proteolytic processing site, from the cDNA sequence, was purified from extracts of and the multiplecopiesofFMRFamide], the general or- H. aspersa ganglia and identified by mass spectroscopy. ganization of these two precursors is similar (see PartialgenesequencesfortheFMRFamideprecursorsof Greenbergand Price, 1992). two closely related pulmonate species Cepaea nemor- Pulmonatesnails,but notothermolluscs,alsocontain alis and Polydontes acutangiila were also determined heptapeptides ofthe form XDPFLRFamide (X = N, S, and compared with the cDNA sequence ofH. aspersa G, pQ) (Price et al., 1990). These heptapeptide analogs and a partial gene sequence previously determined from ofFLRFamideareencodedonadifferentprecursorfrom H. pomatia. Not only are the FMRFamide-related se- FMRFamide (Saunders et al., 1991; Lutz et a/., 1992) quences and proteolytic processing sites conserved, but and are expressed in different neuronal populations the linear arrangement of these landmarks is also re- (Bright et al., 1993; Cottrell et al.. 1992) in both Lym- tained. SyntheticpQFYRFamidehassomeeffectsonthe naeastagnalisandHelixaspersa. InL. stagnalis, thetwo isolated heart and on neuronal potassium currentsin H. precursors are alternatively spliced variants of a single aspersa that are similar to those ofFMRFamide, but it gene which share the same first exon (Saunders et al., does not activate the neuronal FMRFamide-gated so- 1992). Whetherasimilaralternativesplicingmechanism dium channel. occurs in H. aspersa is unclear because only a partial cDNA encoding the tetrapeptides had been previously Introduction isolated (Lutz et al.. 1992), notwithstanding that the The tetrapeptide FMRFamide (Price and Greenberg, cDNA encoding the heptapeptide precursor in //. 1977) is undoubtedly present in all molluscs(Greenberg aspersa hasbeen fully sequenced (Cottrell etal., 1994). and Price, 1992), but the mRNA encoding the Because conservation ofstructure is often associated FMRFamide precursor has only been completely de- with functionally importantregionsofaprotein, andbe- cause the FMRFamide precursor from only one other pulmonate isfully known, wehavedeterminedthecom- Received3September 1996;accepted7October 1996. plete sequence of the FMRFamide precursor in H. 341 34" D. A. PRICE ET AL M13R Helixasperse - T3 PD64 Cepaea nemoralis I? QFYRFG i PD90 "fi QFYRFG Polydontesacutangula KR -PD90 QFYRFL? QFYRFG PD90 RR QFYRFG L PD34 FLRF- PD18 KHR FLRFG KHR FLRFr, -SDQALY -SDQALY^ PD57 -GVKPLY-i PD57 RKRR RKRR RKRR PD12 PD12 PD12 PD92 KR KR KK KK PD75 KR.22; KH +_ .22 R KR + K KR .22 KR PD122 R.22 i FLRF- r PD18 KRK FLRFG- PD11 KKR K PD123- KR KR K PD18 KR KR J-i K PD7 I I I PD9 -1- Figure1. CompositeschematicrepresentationofthecompleteFMRFamideprecursorofHelixaspersa (GenBank L20768)andprecursorfragmentsfrom Cepaeanemoralis(GenBank U02488)andPolydontes ututangula. The noncoding regions are shown as vertical lines and the coding regionsas columns. The columnsarepositionedsothatthetetrabasicsequences(RKRR)commontoallarehorizontallyaligned. THE PEPTIDE pQFYRFAMiDt FROM THE SNAIL 343 aspersa, showing in the process that alternative splicing Libraryconstruction occurs in this species as well as in L. stagnalix. We have RNA was isolated from clusters of neurons located also broadened the comparison by examining two addi- tional pulmonate snail species and have established, in the parietal ganglia of//, aspersa. These clusters con- atfehnaedtrueorbpeyis,stolhfaonbtdhrmeaanrFckhMRmsoFelqaluumesinccdse.es tphraetcusreseomrstoofbepuclommonmaotne tsFiiMsotnRaFlaalcmmDoisNdtAeelnpitebiprraterilydyewsaosf(Ccoontnetsruetrlroluncsetlediaimu,msui1nn9go9rt2eh)ea.cLAtaimvdbeidreatc-o- Theresultingsequenceshaverevealedaputativenovel Zap kit (Stratagene). peptide (pQFYRFamide) that has now been purified PCR from extracts. The pharmacology of FMRFamide-re- amplifications alFsaLtpReedrFspaaem,pitaidndedeshwahevaeskansloormweeadthybaibtoletoehgniecsahtleupdaticaetpdieoepnxtstieodnnesiapvneeralilypohigensr/ao/l.f wbuetPrreaelpuwasareyadstidloienrsesoctjthltayenmipn1l0atth/ueel)DPoNCfARt..heFaomArplliaiqmufpoilteisdfc(itcDyaptNiicAoalnllyiobf5rag^re\y-, organs and neurons that are distinct from those of nomicDNA from CepaeaorPolydontes, asmallpieceof F19M8R7F;aComtitrdeellaannddFDLavRiFeasm,i1d98e7)(.LeWhemahnavaentdheGrreefeonrbeesrugr.- t1i0ssmuein(tyaptic9al5lyC1 ignanagbloiuonticar5in-gf,ol1d0emxgce)swsaosfhe1a0t0edmfMor veyed the pharmacology of synthetic pQFYRFamide NaOH (50 n\ for a ganglion) and was then centrifuged asnodmeroefpotrhte hsearmeetahcatti,onasltashoFuMghRFtahimsipdeentoanpehpetairdtes ahnads Tfohre5smuipnerantamtaanxtiwmausmtrsapnesefderirneadntoEpapcelnedaonrtfucbeentarnifdugdei.- sneoudriounmscohfa/n/n.ealsptehrasta,isitdihraesctlnyogeaftfeecdt boyn FthMeRnFeaumroindael flourtePdC1R0.-fold with water. Aliquots(0.3 to 5 ^1)were used (Cottrell etai, 1990;Green el a/., 1994). Standardamplification. AllofthePCRcomponents, DNA except the polymerase. were assembled in a total Materialsand Methods volume of80 /ul in a0.5-ml tube and overlaid with min- eral oil. The tube was heated to 95C for 10 min, cooled Animals to 80C, the DNA polymerase (Taq, Promega, 2.5 U in 20n\)added through theoil, andthe PCRcycles(Perkin Three species ofsnails from the pulmonate order Sty- ElmerCetus thermal cycler) started (30 to 40 cycles of 1 lommatophora, superfamily Helicoidae, were used in min at 94C, 1 min at 50C, 2 min at 72C). The PmCMR this study. Two species. Helix aspersa and Cepaea ne- reaction mmiMxture contained buffer (Promega: 50 moralis, are members of the family Helicidae and the KC1, 10 Tris-HCl. 0.1% Triton X-100, pH 9.0 at mM third, Polydontes acuiangnla, is in the family Camaeni- 25C), 1.5 Mg, 200 ^Mofeach dNTP(Pharmacia), dae. Note that Lymnaea stagnalis, another frequently template and primers (20 to 200 ^mol). An aliquot ( 10 studied pulmonate, isin theorder Basommatophora. ^1) was run on an agarose gel, and reactions that showed Thosespecimensof//, aspersausedinthepurification products of the expected size were purified for cloning ofpQFYRFamideand in the pharmacological testingof as follows. First, the aqueous phase containing the PCR that peptide on snail hearts were collected in Fullerton, productwasremoved from undertheoil layerand rolled California, and shipped to St. Augustine, Florida, by around on a sheet of Parafilm to remove residual oil Robert A. Koch. The cDNA library was made from //. droplets (Whitehouse and Spears, 1991). The DNA was aspersacollected in St. Andrews, Scotland, and thesean- thMen precipitated by the addition ofan equal volume of imalswerealsousedinelectrophysiologicalexperiments. 5 ammonium acetate followed bytwo volumesofiso- Specimens ofCepaea were collected in Bellmore, New propanol (storage overnight at -20C). The precipitate York, whereas Polydontes were obtained in El Yunque wasthenwashedwith 70%ethanol,driedinaSpeed-Vac, rain forest in Puerto Rico. and resuspended in 10 n\ water. Aliquots (1-7 //I) were Thesixaminoacidresiduesjustupstreamofthetetrabasicsitesarealsolabeled.Thepositionsofindividual peptides are stippled or hatched; the copies ofFMRFamide are not labeled. Putative, amide-donating, glycine residuesare shown asdark linesextendingto the left ofthecolumn. Thin cross-linesdelimit the boundariesofputative,basicprocessingsites. ThesignalsequenceoftheH aspersaprecursorisshown in solidblack.ThesegmentsthatwereamplifiedbyPCR,thenclonedandsequenced.areindicatedbybrackets labeled with the primers used. Alternative amino acid residues encoded by degenerate PCR primersare shown abovethe mostlikelysequenceandarefollowedbyquestion marks. Thevectorregion expectedto adjointheclonedH aspersasequenceisshownwithdottedlines. The// aspersa3'noncodingregion(see Lutze/al.. 1992(extendsfurtherthanshown(indicatedbyatilde). 344 D. A. PRICE KT AL ligated into the pGEM-T vector (Promega). which was PDI22(sense): TT(TC)ATG(CA)GITT(TC)GGIAG- (AG)GGCGA then transformed into E. co/i (JM109). Colonies were analyzed by PCR with primers taken from either side of PDI23(anti-sense): CTTTTTlCGlCCGAACCTCATGAATCT- the cloning site. Clones containing an insert ofthe ap- MI3 rev(NEB# 1233): AGCGGATAACAATTTCACACA- propriate size were sequenced with Sequenase (US Bio- GGA chemicals, Cleveland. Ohio) kits. T3promoter)NEB# 1228): ATTAACCCTCACTAAAGGGA Nested PCR For the initial amplification. 5 ^1 from the library was used as the template for a pair ofprimers. Peptideextraction M [Foran example, consider 13R and PD12; see Fig. 1 for Ganglia were added to acetone to give a final concen- location.] From the initial reaction product. 0.1% to 1% tration of 2 g/10 ml, and left at -20C until processed twwaosuasdedditaisontaelmplpartiemefrosrtchheosseecnonfdraormyatmhpeliftiacrgaettieodnsPwiCtRh ffurrotmhetr,hebutitssaute,lecasetntorviefrungiegdh,t.anTdhethaecseutpoenrenwaatasndtefcialntetreedd product, and only 25 cycles of amplification were done. through plain nylon (0.45-A/m poresize; MSI, Westboro, [Continuingtheexample, seeT3 and PD34 in Fig. I.] Massachusetts). Theclarifiedextractwasreduced in vol- Primers. The followiDnNgAoligonucleotide primers umetoabout 10%on arotaryevaporatorwith heatingto were synthesized by the synthesis facility of the 50C, leaving a primarily aqueous phase that was again University of Florida Interdisciplinary Center for Bio- clarified by filtration. technology Research. Seven of these primer sequences were taken directly from known DNA sequences: PD7. HPLCfractionation PD9, and PD12 are from the FMRFamide-encoding clone HF1 (Lutz el a/., 1992); PD64 is from the hepta- Inallcases, thesampleswerepumpeddirectlyontothe peptide-encoding clone HF4 (also Lutz el it/.. 1992); reverse phase column (2.1 X 200 mm, Brownlee Aqua- M13 rev and T3 promoter are from near the insertion pore Octyl) through the aqueous solvent pump. The ab- siteoftheplasmidcloningvectorBluescript(Stratagene); sorbance of the effluent was monitored at two wave- and PD92 is from the first FMRFamide-encoding PCR lengths(214 and 280 nm), and fractions (about 0.25 ml) product obtained from Polyclnntes. The remainingeight were collected every 30 s. The flow rate was0.5 ml/min primersweredesigned from aminoacidsequencesrather throughout. Fractionstobererun forfurtherpurification than DNA sequences and are degenerate; the mixed were pooled and diluted several-fold with the new aque- bases are parenthetical in the following list. Inosine (I) ous solvent before being loaded onto the column. Three was used in positions where all four bases could encode solvent systems were used: 0.1% trifluoroacetic acid the desired amino acid. Some primers to repeated se- (TFA) in water/0.1% TFA in 80% acetonitrile; the same quencesweredesigned to beonly partially degenerate so with heptafluorobutyric acid (HFBA) substituted for mM that they would not match every repeat exactly. For ex- TFA; and 5 sodium phosphate (pH 7.0) in water/5 ample, PD11. an antisense primer to some DNA se- m.A/sodium phosphate in 60% acetonitrile. RFMRFGK quences encoding (R or S) exactly matches only one repeat in the Cepaea FMRFamide gene. The Radioimmunoassay primer binding sites for all ofthese oligonucleotides are shown in FigPuDr7e 1. CGTGGGGATTCAGAAACATCA- orRQa2d)i,owiamsmuunsoeadsstoaya,nawliytzheetihtehefrroafcttiwoonsanatsisperreavi(oSu2s5l3y (sense): TGA described (Lesserand Greenberg, 1993). PD9 TAGCGCTAGAACCCTACTACC- (anti-sense): GAT Peptidesynthesis PDI 1 (anti-sense): CTTTTCCC(AG)AA(TC)CTCAT(GA)- AA(TC)CG The peptide pQFYRFamide was custom synthesized PDI2(anti-sense): AGATTGTTGGTTAGCGTCAGC- by Research Genetics(Huntsville. Alabama). Otherpep- TGA tides were synthesized by the peptide synthesis labora- PDI8(sense): GGAGITATACG(GAGC)GITTC(TOTG(AC)- toryofthe UniversityofFlorida InterdisciplinaryCenter PD34(anti-sense): A(AG)(AG)AAIC(GT)(CT)TT(AG)- for Biotechnology Research or purchased from Sigma TC(TC)TG(AG)TAIGG Chemical Co. PD57(sense): TCAGA(GC)(GC)AG(GC)CI(CT)- TITA(TC)(AC)GIAA(AG)(AC)G PD64(sense): ACTAGTCTGTGCCTCACCATC Liquidchromatography-massspectrometry(LC-MS) PD75(anti-sense): TTCCC(AG)AA(CT)CTCAT(AG)- Mass spectra were recorded in the positive ion mode AA1C(GT)(CT)TT PD90(sense): (CA)G(GA)CAGTT(TC)TA(TC)CGA- on a TSQ-700 triple quadrapole instrument (Finnigan- (TA)T(TC)GG(CT)(CA)G MAT, San Jose, California) equipped with an electro- PD92(anti-sense): CTCGGCTGTTTGGTTGGCACT spray ion source operatingat atmospheric pressure. The THE PEPTIDE pQFYRFAMiDE FROM THE SNAIL 345 gctaacatcacaagtcgacaaccacttgagtagagcgggactttgttagcacattttagc 60 tcacgtttagtttctaaagaaaaacgtctccacttcgccactcttcgatttggaaacoag 120 catagcaccagggtgtacactcaagtctcacaagcaactacagatca 167 MTSLPDC64 LTIAPAVLS ATG ACT ACT CTG TGC CTC ACC ATC GCC CCG GCC GTG CTC ACT 209 LICLSSYGWAEDNNGI CTC ATC TGC CTG TCC TCG TAT GGG TGG GCT GAA GAC AAC AAC GGA ATC 257 HTLDDGDNDPFFRHNR CAC ACA TTG GAC GAT GGA GAT AAT GAC CCA TTC TTC CGC CAC AAC AGG 305 RAFVPLWDNA CAG TTT TAG CGA TTC GGT AGA GCT TTC GTT CCT CTT TGG GAC AAT GCT 353 Q F Y R F G DDSLVRKNLLTHWSEF GAT GAC TCT TTA GTC CGG AAA AAC CTG CTG ACT CAT TGG TCT GAG TTT 401 PLSPALDDDVFSRNSR CCC TTG TCA CCA GCT CTA GAT GAT GAT GTA TTT TCC AGA AAT AGC CGA 449 RSYPPYQDKPD34R CAG TTC TAC CGA TTC GGC CGC TCC TAC CCT CCT TAG CAA GAT AAA CGA 497 Q F Y R F G RSHQPDIDEYL TTT CTC CGG TTC GGA AGA TCT CAC CAG CCG GAT ATT GAT GAA TAT TTG 545 F L R F G QALNSDQALYRKRRSE CAG GCC TTG AAT TCA GAC CAG GCT TTG TAT AGG AAA AGG CGA TCA GAA 593 DGDSKEDGLNRVARSA GAT GGA GAT TCC AAA GAG GAT GGT CTG AAC CGA GTT GCC CGT TCA GCT 641 PD12 GAC GCT AAC CAA CAA TCT 659 D A N Q Q S Figure2. Thenucleotideanddeducedaminoacidsequencesofthe5'endoftheFMRFamideprecursor from Helixaspersa. Thebindingsitesfortheindicatedprimers(PD64, PD34.and PD12)areunderlined. Theportionofthesequencethatisidenticaltotheheptapeptideprecursorisshaded,andtheaminoacids ofthematurepeptides(includingtheamidedonor,glycine)aredoubleunderlined. electrospray needle was operated ata voltagedifferential Recordingfromidentifiedneurons. Electrical record- of 3-4 kV, and a sheath flow of 2 ^1/min of meth- ingsweremadefrom two identified neurons(Cl andC2) oxymethanol was used. Scans were acquired every 3 s in the cerebral ganglia ofH. aspersa; neither neuron is (Swiderek^a/., 1996). a known follower ofa FMRFamide-containing cell (see The chromatography was performed on a microcapil- Cottrell and Davies, 1987). The physiological solution lary high-performance liquid chromatography (HPLC) had the following composition (mAf): NaCl (90), KC1 system built at the Beckman Research Institute, City of (5), MgCl2 (5), CaCl2 (7), HEPES (20), and the pH was Hope(Daviselal, 1994, 1995). Fusedsilicacolumnswith adjusted to 7.4 with NaOH. Neurons were voltage an innerdiameterof250 ^m were packed with Vydac 3- clamped with a Dagan 8100 single electrode clamp sys- ^m C18 RPsupport. The samplewaseluted with agradi- tmeMm with low-resistance micropipettes containing 200 ent from 98% solvent A (0.1 1% TFA) to 62% solvent B KC1. Peptide solutions (100 nM} were prepared in (90% acetonitrile, 0.07% TFA)over30 minwithaflowof an appropriate physiological medium and were usually 2 /il/min. The UV absorbance (200 nm) was monitored pressure applied (Picospritzer II, General Valve Corpo- beforethesamplewasintroducedintothemassspectrom- ration). However, a barium-containingphysiological so- mM mM eter. Spectra were generated by averaging scans contain- lution (10 KC1, 25 BaCl2, 5 mAf MgCl:, 75 ing the peak, and the masses were calculated with data mA/tetraethylammonium chloride, 3 mA/4-aminopyr- MAT reduction software (Finnigan BIOMASS). The de- idine, 5 mA/Tris HC1, pH 7.5)was usedduringthe mea- termined mass values ofthe molecular ions are accurate surement ofcurrents passing through calcium channels, to within a few tenths of a dalton, reported values are and the peptide was added to the bathing solution prior rounded downtothenearestintegral value. tothegeneration ofacurrent-voltagecurve. Results Biologicalassays The isolated heart. The perfused ventricle of H. ThecompletesequenceofthemRNA encodingthe FMRFamide aspersa was used as described previously (Lesser and precursor Greenberg, 1993)toassay thecardioactivity ofsynthetic A partial sequence had previously been isolated from pQFYRFamide. a Helix aspersa cDNA library; it extended from an CGA CAG TTC TAC CGA TTC GGC CGC TCC TAC CCT CCT TAC CAA GAT AAA CGA H asp AAG GG TG G T A G C H pom G AT A G CGA T C nem T T A A ACT A T ATG GA P acu Arg Gin Phe Tyr Arg Phe Gly Arg Ser Tyr Pro Pro Tyr Gin Asp Lys Arg H asp Lys Arg Leu Ala H pom TAG C nem lie Gin His Met Gly P acu TTT CTC CGG TTC GGA AGA TCT CAC CAG CCG GAT ATT GAT GAA TAT TTG H asp C H pom T T C nem T A A T C C C TA A T A G C CT T GG CAT AAT P acu Phe Leu Arg Phe Gly Arg Ser His Gin Pro Asp lie Asp Glu Tyr Leu H asp Gly H pom C nem Leu Asn Val Leu Asp Gly His Asn P acu CAG GCC TTG AAT TCA GAC CAG GCT TTG TAT AGG G T C C G G T C ATT CCT TTT TTT GT C A GGC TT A C A C - Gin Ala Leu Asn Ser Asp Gin Ala Leu Tyr Glu Ser His Pro - Glu Ser His lie Pro Phe Phe Val Gin Gly Val Lys Pro THE PEPT1DE pQFYRFAMior FROM THE SNAI1 347 EcoRI site 21 nucleotide residues upstream ofthe tetra- PCR amplification ofOtherFMRFamidegene basicsequence(RKRR; indicatedon Fig. 1), through the fragments 3'noncodingregion (Lutzeta/., 1992). Wehave used the DNA PCR-based strategy illustrated in Figure 1 to determine from ganglia ofthe helicid snail Cepaea neinor- the sequence of the missing 5' end of the cDNA. This alis and the camaenid snail Polydontes acutangula was additional sequence (shown in Fig. 2), taken together prepared by crude alkaline lysis and amplified by PCR. with that ofLutz etal. ( 1992), completesthesequenceof In addition to the primers that had been employed for the FMRFamide precursorof//, aspersa. The precursor amplifications in Helix, we used another (PD92) that is diagrammed in Figure 1, and the complete sequence was synthesized to match exactly the P. acutangula se- hasbeen deposited in GenBank, Accession L20768. quence(see Fig. 1 ). The 5'endofthecDNA and thepeptide precursorthat From C. nemoralis we obtained overlapping frag- it encodes [derived from these data and those ofLutz et ments covering much ofthe precursor, as shown in Fig- al. (1992)] contain fournoteworthy features(Fig. 1): ure 1 (for sequence see GenBank Accession U02488). First, the 243 bases at the 5' terminal (including the The sequence ofthe Cepaea precursor is very similar to noncoding region and the signal sequence) are identical that ofthetwospeciesofHelix(Figs. 1 and 3; Lutzetal.. tothose ofthecDNA encodingthe precursorofthe hep- 1992). Within the portion ofthe precursorthat has now tapeptide analogs of FMRFamide (Lutz et al., 1992). been sequenced from all three species, the Cepaea pre- Therefore, the two transcripts (i.e.. those encoding the cursor has 88% nucleotide (nt) and 84% amino acid (aa) FMRFamide and heptapeptide precursors, respectively) identity to //. aspersaand 90% ntand 81%. aaidentityto must be derived by alternative RNA splicing, a finding H. pomatia, and the two Helixspecies have 89% nt and also reported forLymnaeastagnalis(reviewed by Benja- 86% aa identitytoeach other. minand Burke. 1994). The lineararrangement in the precursorsofCepaea Second, downstream from the signal sequence, the 5' and H. aspersa of the landmarks described above is cDNA segment also encodes two copies ofa previously virtually identical. In particular, the Cepaea precursor unknown pentapeptide pGlu-Phe-Tyr-Arg-Phe-NH: also encodes two copies of pQFYRFamide, a copy of (pQFYRFamide) aswell asa copy ofFLRFamide. FLRFamide,atetrabasicsite, andadibasiccleavagesite. Third, 60 base pairs downstream from this FLRFam- Moreover, all ofthese featuresare in the same orderand ide, the cDNA encodes the tetrabasic cleavage site (Arg- in virtually the same positions as in H. aspersa; the ex- Lys-Arg-Arg; RKRR) reported previously (Lutz et al.. ception is that the distance between the dibasic cleavage 1992). The RKRR site also occurs inAplysia californica site and the first copy ofFMRFamide is one amino acid (Taussigand Scheller, 1986)and L. stagnalis(Benjamin longer in Cepaea (Figs. 1 and 3). As expected, the seg- and Burke, 1994.) ments between these landmarks are also very similar at Finally, 1 1 1 base pairs downstream, about 3/5 of the both the aminoacid and nucleotide levels(Fig. 3). distancebetween thetetrabasic(RKRR)siteand thefirst Although we haveamplifiedonlyasmall portion ofthe copyofFMRFamide, thecDNAencodesadibasiccleav- FMRFamide gene from P. aculangula (Fig. 1), most of age site (KR). This site is also found in Aplysia califor- the landmarks found in the cDNA from H. aspersa and nica and L. stagnalis (Taussig and Scheller, 1986; Lin- Cepaea are present and recognizable. The 5' end of the acre et al.. 1990), but its relative position between sequence encodes a copy of FLRFamide, the tetrabasic the tetrabasic sequence and the first FMRFamide repeat site, and the dibasic cleavage site. Upstream from the varies. FLRFamideisthesitewherePCRprimerPD90annealed; DNA In summary,thecomplete,derived precursor includes this primer wasdesigned to hybridize to sequences 10 copies ofFMRFamide, 2 copies ofFLRFamide (one encoding either pQFYRFamide or pQFYRIamide. Al- in the midst ofthe FMRFamide repeats), 2 copiesofthe though the PCR product that was cloned and sequenced novel pentapeptide pQFYRFamide, and 2 conserved containsthe code for He, wecannot be surewhich amino cleavage sites in addition to those flanking the FMRF- acid isactuallycoded forin the native DNA. amide-related peptides. Incontrast tothe landmarksthemselves, the segments Figure3. Adetailedcomparison ofthe nucleotideand aminoacidsequencesfrom the mid-portion of theFMRFamideprecursorsofHelixaspersa(Hasp),Helixpomatia(Hpom,takenfrom LutztYoA. 1992), Ci'piu'a nemoralis (C nem), and Polydontesaculangula (Pacu). The nucleotide sequences are shown in italics,andthematureFMRFamide-relatedpeptidesareshown inbold.Thesequenceswerealignedbythe introduction ofgaps( )tokeeptheboxedcommon features(pQFYRFamide.tetrabasicsite, Lys-Arg, and firstcopyofFMRFamide) in register. Thecomplete nucleotideand aminoacid sequencesareshown onlyforH.aspersa. Fortheotherspecies,onlythedifferencesfrom// aspersaareindicated,exceptforthe gaps;thegapsarerepresentedbydasheswherevertheyoccur. 348 D. A. PRICE ET AL between them are poorly conserved in P. acutangula (Fig. 3). The precursorin thisspecies isonly 41% identi- cal to H. aspersa at the nucleotide level, and 34% at the amino acid level. Moreover, although the overall length of the region between the two outside landmarks pQFYR (I/F) amide and FMRFamide (see Fig. 1) is exactly the same as forH. aspersa, three off-setting gaps wererequired toalignthetetrabasicanddibasiccleavage sitesin thetwospecies. Foranotherexample,thepeptide just 5'ofthe tetrabasic site isespecially dissimilarto that ofH. aspersa: i.e., it is longer (23 amino acids instead of 20)and, even with thegaps, only 17% conserved. 10 15 20 30 Time(min) IsolationofpQFYRFamide The predicted peptide pQFYRFamide was synthe- 100 -, 742.0 sized; it was as reactive as FMRFamide in an RIA with antiserum S253 which facilitated the purification. The 80 c synthetic peptide eluted at 12-13 min in the TFA/ACN Ao solvent system, i.e.. coincident with a large peak ofim- Loi.n 60 - munoreactivity observed with H. aspersa ganglion ex- < tracts (see Price et al., 1990, fora typical pattern). Since _o>> 40 - thislargepeak alsocontainsSDPFLRFamideand NDP- "o FLRFamide, we sought a second solvent system that 0. 20 - couldseparatepQFYRFamide from thesetwoheptapep- tides; the phosphate/ACN system proved to be satisfac- 600 800 1000 1200 1400 1600 1800 2000 tory. m/Z This fractionation procedure, with one modification, Figure 4. The purification and identification ofpQFYRFamide. was applied separately to two H. aspersa extracts, one (A)TheUVabsorbance(214nm)profileandahistogramoftheimmu- made from 50 pairsofcerebral ganglia and another from noreactivity(determined with antiserum S253)ineach fraction ofthe 30 subesophageal ganglia. The cerebral ganglion extract columneffluentisshownforthefinalHPLCstep(elutedwiththeTFA/ wAaCsNgisvyesntema.pTrheelriemaifntaerr,yefarcahcteixotnraatcitownawsiftrhactthieonHatFeBdAo/n tAtiwCoenNenwastoshlevmeaUndtVe.sry(esBct)oermMd,aesrsesaensMpdeecttthhroeadlfsra)an.catlTiyohsneisrceoolfilstehcaetodmrealfaioynrowifhmiamcbuhonuontroe3ac0ocrtsribevece-- a TFA/ACN gradient, and the immunoreactive peaks peak(12min)fromthefractionationillustratedinA.Theobservedm/ from this run were further resolved with the phosphate/ z value(mass:charge ratio)of742 correspondstothecalculated value ACN solvent system. On this system, the cerebral gan- forpQFYRFamide. glionextractshowedalargepeakat 19 mincorresponding to synthetic pQFYRFamide, and a small peak at 16 min corresponding to the two heptapeptides (which are not separated in thissystem). The subesophageal ganglionex- FMRFamide(Fig. 5). FYRFamidewasabout halfaspo- tract contained peaks of heptapeptide (16 min) and tentas FMRFamide, whereaspQFYRFamidewasabout pQFYRFamide (19 min) of roughly equal size (not 5 times more potent. Thus, blocking ofthe N-terminal shown). The pQFYRFamide peaks from both purifica- by addition ofpyroglutamic acid increases the potency tions were combined and run through a final TFA/ACN ofFYRFamide by 10-fold. Payza (1987) also noted that system.Themajorpeak(12to 12.5 min;Fig.4A)wassub- FMRFamide analogs with blocked N-terminals were jected to combined HPLC/mass spectrometry, revealing more potent on the heart than thosewithout. a molecular ion at 742 (Fig. 4B) in agreement with the calculated valueof742. Sincethispeptideeluted from the Responsesofidentifiedneuronsof Helixaspersa HPLC column at the same time as synthetic pQFYRF- Potassium current evokedin the Cl neuron. FMRF- amideand hadthesamemassaspQFYRFamide,wecon- amide induces a slowly developing hyperpolarization of clude that it ispQFYRFamide. theCl neuronthat resultsfrom an increasein potassium conductance (Cottrell and Davies, 1987). In normal CardioactivityofpQFYRFamide physiological solution (see Methods) pQFYRFamide TheeffectsofsyntheticpQFYRFamideontheisolated evoked a response similar to that ofFMRFamide (n = heart of H. aspersa were compared with those of 5);e.g., undervoltageclampat -45 mV,anoutwardcur- THE PEPTIDE pQFYRFAMlDE FROM THE SNAIL 349 FMRFamide FYRFamide pQFYRFamide 10~6 M 2x1O"6 M 2x10"7 M 2x10"6 M 4x1O"6 M 4x10"7 M 4x1O'6 M 10~5 M 10~6 M 2 min Figure 5. Representative recordingsofthe mechanical activityofan isolated perfused heart ofHelix aspersa.Abolus(100^1)oftheindicatedconcentrationofpeptidewasintroducedintotheperfusingstream atthearrow;thisvolumecorrespondstoabout30sofflow. rent accompanied by an increased membrane conduc- 1987), an effect mediated by the direct activation ofso- tance was recorded (Fig. 6A). At a holding potential of dium channels(Cottrell et al.. 1990; Green et ai. 1994). -100 mV the direction ofthe current response was in- A comparison of the effects of FMRFamide and ward (bottom record, Fig. 6A). The relationships be- pQFYRFamide, recorded under voltage clamp from the tween evoked current and holding potential were com- wholecell (see Fig. 7), clearlyshowsthatpQFYRFamide pared in normal physiological solution (containing fails to evoke this fast inward current (n = 7). Appar- 5 mA/K) and in a saline with reduced potassium ently, pQFYRFamide cannotactivatethe FMRFamide- (1.5 mA/), as shown in Figure 6B. The shift in reversal gated sodium channel. potential produced by reducing the potassium concen- Potassium current evoked in the C2 neuron. Some tration was about 30 mV, close to that predicted for a C2 neurons, but not the example shown in Figure 7, re- response mediated entirely by a change in potassium spondedto FMRFamidewithaweakoutwardcurrent in conductance. FMRFamide and pQFYRFamide both addition to the fast response. This outward current, like had EC50valuesofabout2 nM, butpQFYRFamidecon- theslow hyperpolarization observed in manyH. aspersa sistently produced a larger maximum effect (about 50% neurons, is due to an increased potassium conductance greaterthan thatofFMRFamide). (seeCl neuron above). pQFYRFamidealso, andconsis- Suppression ofa voltage-dependent calcium current in tently(n = 7),evokedaslowoutwardcurrent(Figs. 7and the Cl neuron. FMRFamide reduces the voltage-de- 8A) that was accompanied by an increase in membrane pendent calcium current by up to 30% (Colombaioni et conductance (Fig. 8A). This response inverted close to a/., 1985; Cottrell and Lesser, 1987). pQFYRFamide the potassium equilibrium potential (Fig. 8B) in both also reversibly reduced the amplitude ofthe Ca current normal and reduced potassium solutions (based on [K,] and by a similar amount (/; = 4; data not shown). The = 98 mA/, Alvarez-Leefmans and Gamino, 1982). It is, EC50 for pQFYRFamide was similar to that for therefore, very similar to the slow increase in potassium FMRFamide, i.e.. about 5 ^m. conductance induced by FMRFamide and described FastsodiumcurrentevokedintheC2neuron. FMRF- abovefortheCl neuron(Fig.6;andCottrelletal.. 1984); amide was shown to produce a rapidly developing in- the EC50 values for pQFYRFamide and FMRFamide ward current in the C2 neuron (Cottrell and Davies, weresimilar about 1 /J.AI. 350 D. A. PRICE ET AL A Vh= -45 mV vh= -45mv pQFYRFa Vh=-35mV Vh= -80 mV \r Vh=-100mV pQFYRFa 0.5 nA pQFYRFa j 10s B Figure 7. Comparison of currents evoked by FMRFamide and 1.5mM K pQFYRFamide in theC2 neuron. At a holdingpotential of-45 mV. pQFYRFamide evoked an outward current, whereas FMRFamide evoked a fast inward current. Even at -80 mV, close to the reversal potential forthepotassium response, noinwardcurrent in responseto pQFYRFamide was seen. Identical results were obtained in experi- mentsinwhichtheorderofapplicationwasreversed(notshown). The amino acid segments that are processed to be- come the individual mature peptides are not distributed at random in the precursors, rather, they are clustered Figure6. EffectsofpQFYRFamideon aCl neuron fromthecere- according to their sequences in two domains. First, the btrhaelpgeapntgildieaaotfdHicffleir\enItM/hKoVl.WdJin(gAp)otEexnatmiapllses(Vho)f.thIenctuhreretnotpsreevcoorkde,dtbhye C-terminal end ofthe precursor (always downstream of voltage was periodically stepped to -50 mV to monitor the conduc- the tetrabasic sequence, RK.RR) is the site of repeated tance: notethat thecurrent pulsesin responsetothe -5 mV stepsare segments, each comprising a FMRF sequence with its about twice as large at the peak ofthe response as in the control. (B) processing signals and acidic spacers. Second, the N-ter- Relationship between peak evoked current and holding potential for responsesinphysiologicalsolutionscontainingnormal(5 m.M. circles) or reduced (1.5 mM, squares) concentrations ofpotassium. The data showninthegraphweretaken fromanexperimentonasingled neu- ron.Asecondexperimentgavethesameresult. Vh=-45mV 0.2nA | pQFYRFa 2s Discussion We have sequenced the 5' end ofthe cDNA encoding the FMRFamide precursor ofHelix aspersa. and so the B 0.8 entire sequence is now complete. The general organiza- 1.5mMK- tion ofthis precursor is similar to that ofthe two other 0.6 completely sequenced FMRFamide precursors: Lym- 5mM K- naeastagnalis(reviewed by Benjamin and Burke, 1994) 0.4 andAplysia californica (see Taussigand Scheller, 1986). > The similarity is manifest in both the splicing pattern 0.2 and in the lineararrangement oflandmark sequences in the precursor. The mRNA encoding the FMRFamide precursor in -120 -100 -60 -40 -20 allthreespeciesiscomposed ofat leasttwoexons, and in Vh(mV) L -0.2 all three the splicejunction is in a roughly similar posi- Figure8. (A)TheeffectofpQFYRFamideontheC2neuronat-45 tion. In both Lymnut'ii and Helix the first exon of the mV isaccompanied byan increaseinconductanceasindicatedbythe FMRFamideprecursorisalternativelysplicedtogivean- increase in current pulsesevoked by periodically steppingthe voltage other neuropeptide precursor (that ofthe FLRFamide- ttioal-(8V0h)mVfo.r(rBe)spRoenlsaetsioenvsohkiepdbientwpeheysniopleoagkiccaulrrseonltutainodnshcoolndtianignpiontgeeni-- related heptapeptides), but noalternativelyspliced prod- therthe normal (5 m.M, circles)orreduced(1.5 m.U, squares)level of uct haseverbeen found in Aplysin. potassium inanexperimentonasingleC2 neuron.

See more

The list of books you might like