loading

Logout succeed

Logout succeed. See you again!

ebook img

Streamlining DNA Barcoding Protocols PDF

pages12 Pages
release year2014
file size2.47 MB
languageEnglish

Preview Streamlining DNA Barcoding Protocols

RESEARCHARTICLE Streamlining DNA Barcoding Protocols: Automated DNA Extraction and a New cox1 Primer in Arachnid Systematics Nina Vidergar1,5, Natasˇa Toplak4, Matjazˇ Kuntner1,2,3* 1.InstituteofBiology,ScientificResearchCentreoftheSlovenianAcademyofSciencesandArts,Ljubljana, Slovenia,2.CentreforBehaviouralEcology&Evolution,CollegeofLifeSciences,HubeiUniversity,Wuhan, China,3.NationalMuseumofNaturalHistory,SmithsonianInstitution,Washington,DC,UnitedStatesof America,4.Omegad.o.o.,Ljubljana,Slovenia,5.MolecularVirologylab,InternationalCentreforGenetic EngineeringandBiotechnology–ICGEB,Trieste,Italy *[email protected] OPENACCESS Citation:VidergarN,ToplakN,Kuntner M(2014)StreamliningDNABarcodingProtocols: Abstract AutomatedDNAExtractionandaNewcox1Primer inArachnidSystematics.PLoSONE9(11): e113030.doi:10.1371/journal.pone.0113030 Background: DNA barcoding is a popular tool in taxonomic and phylogenetic Editor:Damon P.Little,TheNewYorkBotanical studies, but for most animal lineages protocols for obtaining the barcoding Garden,UnitedStatesofAmerica sequences—mitochondrial cytochrome C oxidase subunit I (cox1 AKA CO1)—are Received:June11,2014 not standardized. Our aim was to explore an optimal strategy for arachnids, Accepted:October17,2014 focusing on the species-richest lineage, spiders by (1) improving an automated Published:November21,2014 DNA extraction protocol, (2) testing the performance of commonly used primer Copyright:(cid:2)2014Vidergaretal.Thisisan open-accessarticledistributedunderthetermsof combinations, and (3) developing a new cox1 primer suitable for more efficient theCreativeCommonsAttributionLicense,which alignment and phylogenetic analyses. permitsunrestricteduse,distribution,andrepro- ductioninanymedium,providedtheoriginalauthor Methodology: We used exemplars of 15 species from all major spider clades, andsourcearecredited. processedarange of spidertissuesof varyingsizeand quality, optimizedgenomic DataAvailability:Theauthorsconfirmthatalldata DNA extraction using the MagMAX Express magnetic particle processor—an underlying the findings are fully available without restriction. All relevant data are within the paper automated high throughput DNA extraction system—and tested cox1 amplification anditsSupportingInformationfiles. protocolsemphasizingthestandardbarcodingregionusingtenroutinelyemployed Funding:Thisresearchwassupportedbythe primer pairs. SlovenianResearchAgency(grantsP1-0236and MR-2013)andaSwissContributiontotheenlarged Results: The best results were obtained with the commonly used Folmer primers EUgrant(C1536-11T440013).Thefundershadno roleinstudydesign,datacollectionandanalysis, (LCO1490/HCO2198)thatcapturethestandardbarcoderegion,andwiththeC1-J- decisiontopublish,orpreparationofthemanu- 2183/C1-N-2776 primer pair that amplifies its extension. However, C1-J-2183 is script. designed too close to HCO2198 for well-interpreted, continuous sequence data, CompetingInterests:Oneoftheauthors(N.T.)is employedbyacommercialandresearchcompany, andinpracticetheresultingsequencesfromthetwoprimerpairsrarelyoverlap.We Omegad.o.o.,Slovenia,initsresearchdepart- thereforedesigneda newforwardprimerC1-J-2123 60basepairs upstreamofthe ment.Thecompanysupportedthisresearchby makingavailablereagentsandthisresearcher’s C1-J-2183bindingsite.Thesuccessrate ofthisnewprimer(93%)matchedthatof time,andbycontributingtowardscoveringthe C1-J-2183. PLOSONEopenaccessfeeforthisarticle’s publication.Thisdoesnotaltertheauthors’ Conclusions: The use of C1-J-2123 allows full, indel-free overlap of sequences adherencetoPLOSONEpoliciesonsharingdata andmaterials. obtained with the standard Folmer primers and with C1-J-2123 primer pair. Our PLOSONE | DOI:10.1371/journal.pone.0113030 November21,2014 1/12 DNABarcodingandaNewcox1Primer preliminary tests suggest that in addition to spiders, C1-J-2123 will also perform in otherarachnidsandseveralotherinvertebrates.WeprovideoptimalPCRprotocols for these primer sets, and recommend using them for systematic efforts beyond DNA barcoding. Background and Objectives DNA barcoding in animals routinely uses the mitochondrial gene cytochrome C oxidase subunit I (cox1, also CO1) [1–8] and the same gene is also among the usual markers employed in phylogenetic, genetic and genomic analyses [9–27]. In spiders and other arachnids, the standard barcoding region — 650 base pair long fragment of cox1 — is usually targeted with the use of a few selected primer pairs (Table 1). For phylogenetic and phylogenomic analyses, however, a longer stretch of cox1 is targeted [9,13–14,28–29], but the primer pairs, or combinations of them yielding these nucleotide data may provide only limited amplification success [12,30–32] whose outcome are data deficient alignments between two targeted cox1 regions such as between those targeted by the Folmer region [33] and the C1-J-2183/C1-N-2776 extension [28,30] (Fig. 1). Such indel region, arising through incomplete or poor reads, is artificial due to simple lack of data, and may reduce the accuracy of phylogenetic analyses. Theobjective ofourstudywastoexploreanoptimalstrategyforextractingand analyzing arachnid DNA focusing on the barcoding and adjacent cox1 regions. Our work focused on the species richest arachnid lineage, spiders. Our first goal was to improve an automated DNA extraction protocol. Compared with manual extraction procedures using kits, robotic DNA extraction methods often yield lower quantity of extracted DNA [34]. To maximize its efficiency, we experimentally adjusted an internal robotic DNA extraction program and improved it for acquisition of high concentration of genomic DNA from different quality tissues. Our second goal was to test the performance of commonly used cox1 primer combinations and to identify the optimal primer set over the major phylogenetic lineages of spiders. We screened and tested the high throughput utility with a single PCR program of ten cox1 primer pairs. Our third goal was to develop a new cox1 primer that would produce an indel-free alignment resulting in more accurate phylogenetic analyses. Materials and Methods Specimens and taxonomic coverage Fifteen spider species were selected to represent all major spider clades [14,35] (Table 2; Fig. 2). Specimens were obtained from the EZ Lab tissue bank (http:// PLOSONE | DOI:10.1371/journal.pone.0113030 November21,2014 2/12 DNABarcodingandaNewcox1Primer Table1.Commoncox1primersusedinarachnidsystematics,andtestedinthisstudy. Name PrimerSequence Reference LCO1490 GGTCAACAAATCATAAAGATATTGG [33] HCO2198 TAAACTTCAGGGTGACCAAAAAAT [33] C1-J-2183 CAACATTTATTTTGATTTTTT [30] CO1-J-1718 GGAGGATTTGGAAATTGATTAGTTCC [30] C1-N-2776 GGATAATCAGAATATCGTCGAGG [28] dgLCO1490 GGTCAACAAATCATAAAGAYATYGG [40] dgHCO2198 TAAACTTCAGGGTGACCAAARAAYCA [40] CO1-N-2735 AAAATGTTGAGGGAAAAAATGTTA [41] Chelicerate_R2 GGATGGCCAAAAAATCAAAATAAATG [42] CO1-RCF1 GTYTCTTCWATAGTWGAAATRGG [43] CO1-RCR1 ACAGAAAAYATATGATGRGCYCAYAC [43] C1-J-2123 GATCGAAATTTTAATACTTCTTTTTTTGA Thisstudy doi:10.1371/journal.pone.0113030.t001 Figure1.Anartificialindelregioninthealignmentofcox1sequencesbetweentheFolmerregionandtheC1-J-2183/C1-N-2776extension.Such indelregionarisingduetoincompleteorpoorreads,commonlyhamperstheaccuracyofphylogeneticanalyses. doi:10.1371/journal.pone.0113030.g001 PLOSONE | DOI:10.1371/journal.pone.0113030 November21,2014 3/12 DNABarcodingandaNewcox1Primer Table2.Thesuccessrateofdifferentprimercombinationsforthefifteenselectedspiderspeciesvariesfrom100%to30%. LCO- dgLCO- C1-J- C1-J- CO1-J- CO1- CO1- LCO- Primerpair 1490 LCO-1490 1490 dgLCO-1490 2123 2183 1718 RCF1 RCF1 1490 HCO- dgHCO- C1-N- C1-N- CO1-N- CO1- CO1-N- C1-N- 2198 Chelicerate_R2 2198 Chelicerate_R2 2776 2776 2735 RCR1 2735 2776 Voucher SelectedSpecies SampleNr. Nr. (seeTree) 1 ARA0239 Agelenalabyr- 100% 100% 100% 100% 100% 100% 100% 100% 100% 100% inthica 2 ARA0240 Liphistiussp. 100% 100% 100% 100% / 100% / / / / 3 ARA0111 Urocteadurandi 100% 100% 100% 100% 100% 100% 100% / / 50%** 4 ARA0120 Amaurobiuserberi 100% 100% 100% 100% 100% 100% 100% 100% 100% 100% 5 ARA0174 Atypuspiceus 100% 100% 100% 100% 100% 100% / / / / 6 ARA0001 Araneusangulatus 100%* 100% / 100% 100% 100% 100% 100% 100% / 7 ARA0003 Pholcusphalan- 100% 100% 100% / 100% / / / / / gioides 8 ARA0004 Linyphiatriangu- 100% 100% 100% 100% 100% 100% / / / / laris 9 ARA0241 Hyptiotespara- 100% 100% 100% 100% 100% 100% 100% / / / doxus 10 ARA0242 Clubionaterrestris 100% 100% 100% 100% 100% 100% 100% 100% / / 11 ARA0243 Pardosariparia 100% 100% 100% 100% 100% 100% 100% 100% 100% / 12 ARA0029 Steatodabipunc- 100% 100% 100% 100% 100% 100% 100% 100% 100% / tata 13 ARA0062 Evarchaarcuata 100% 100% 100% 100% 100% 100% 100% 100% 100% 100% 14 ARA0244 Dysderaninnii 100% 100% 100% 100% 100% 100% / 100% / / 15 ARA0081 Misumenavatia 100% 100% 100% 100% 100% 100%* 100% 100% 100% 100% Successful 15 15 14 14 14 14 10 9 7 5 inNr. Success 100% 100% 93% 93% 93% 93% 67% 60% 47% 30% Rate VouchernumbersrefertoEZLab(http://ezlab.zrc-sazu.si/)cryo-collection. *excisedgelbandusedfor2ndPCR;**onlyC1-N-2776binds,onewaysequenceobtained. doi:10.1371/journal.pone.0113030.t002 ezlab.zrc-sazu.si/)foreverynumbered speciesandthesizeoftissuesamplesvaried from 0.3 to 3.0 mm3 volume of spider’s leg. Automated DNA extraction Robotic DNA extraction was done with MagMAX Express Magnetic Particle Processor (Life Technologies). DNA from muscle cells was extracted from fresh tissueortissuefrozenat-80˚Caftercollectionandspeciesidentification.DNAwas extracted using MagMAX DNA Multi-Sample Kit (Life Technologies) by modifying the manufacturer protocol for manual extraction. The MagMAX plate was loaded as follows; row A: 80 mL of Multisample DNA Lysis Buffer, 96 mL of Isopropanol, 80 mL of tissue sample in phosphate buffered saline (PBS: 137 mM NaCl, 2.7 mM KCl, 8 mM Na HPO , and 2 mM KH PO , 2 4 2 4 PLOSONE | DOI:10.1371/journal.pone.0113030 November21,2014 4/12 DNABarcodingandaNewcox1Primer Figure2.Fifteenselectedspiderspecies(seeTable2)representingthemajorphylogeneticlineagesonasimplifiedphylogeny[35]. doi:10.1371/journal.pone.0113030.g002 PLOSONE | DOI:10.1371/journal.pone.0113030 November21,2014 5/12 DNABarcodingandaNewcox1Primer pH 7.4);intorowB:120 mLofWashSolutionI,intorowC,E,F:120 mLofWash SolutionII,intorowD:38 mLofnuclease-freewater,intorowG:40 mLofElution Buffer I. During the run in the MagMAX Express Magnetic Particle Processor the magnetic beads solution (6.4 mL DNA binding beads with 9.6 mL nuclease-free water) into row A and 2 mL of RNase A into row D were added. In second pause 40 mL of Multisample DNA Lysis Buffer and 48 mL of Isopropanol were added into row D. During the third pause a step of incubation in thermoblock at 70˚C for 5 min was made. After the incubation, 40 mL of Elution Buffer II was added into row G (from 70 mL down to 30 mL minimum is allowed) and the run continued in the instrument. Samples of purified DNA were transferred to cryovials for storage from row G (see Appendix S1). TheadditionalstepofovernightincubationofstartingmaterialwithProteinase K was added to the protocol improving extraction efficiency. Differently sized tissue was cut and thoroughly homogenized with a pestle in a tube with 73.6 mL PK Buffer and 6.4 mL Proteinase K (100 mg/mL), shortly centrifuged and incubated over night at55˚C onashaker. Allreagents and buffers (with exception of PBS) used for DNA extraction are components of MagMAX DNA Multi- Sample Kit (Life Technologies). During the optimization step with MagMAX DNA Multi-Sample Kit also the comparison with MagMAX Total Nucleic Acid Isolation Kit (Life Technologies) was done (data not shown). After the quantification of extracted nucleic acids with NanoDrop Lite (Thermo Scientific) the amount of extracted DNA was up to 5-fold higher in comparison to sample concentration prepared with MagMAX DNA Multi-Sample Kit. However, better extraction of nucleic acids could also be related to the MagMAX Total Nucleic Acid Isolation Kit specifications where the isolation of all the nucleic acids (ssDNA, dsDNA and RNA) is performed at once. The comparison of material costs showed substantial differences between the kits used in this study, with the MagMAX DNA Multi-Sample Kit being the most economic. PCR optimization strategy For PCR amplification reaction we achieved the best results using GoTaq Flexi Polymerase Kit (Promega) and the cycling program for cox1 gene. All of the PCR reaction mixtures had a total volume of 25 mL and 1 mL of DNA template (in the range between 3.0 to 50 ng) per reaction was generally used. Each reaction included 5.1 mL of Promega’s GoTaq Flexi Buffer, 0.14 mL of GoTaq Flexi Polymerase, 2.5 mL dNTP’s (2 mM each), 2.3 mL MgCl (25 nM), 0.5 mL of each 2 primer (forward and reverse, 20 mM), 0.14 mL BSA (10 mg/mL) and 12.8 mL of sterile distilled water. The thermocycle program for cox1 amplification consisted of 95˚C for1 min,5 cycles of 94˚Cfor 40 sec, 45˚Cfor 40 sec and 72˚Cfor 1 min. Additional 35 cycles of 94˚C for 40 sec, 51˚C for 40 sec and 72˚C for 1 min with a final extension at 72˚C for 5 min were used. Two samples were amplified with a second round of PCR using the excised band as a template. All reagents and buffers used for PCR were supplied from Promega. PLOSONE | DOI:10.1371/journal.pone.0113030 November21,2014 6/12 DNABarcodingandaNewcox1Primer PCR amplification verification and sequencing PCR products were stained with Sybr Safe (Invitrogen), separated by standard 1.5% agarose gel using Owl B2 EasyCast Mini Gel Electrophoresis System and visualized by UV gel imager E-box VX2/20LM (Vilber Lourmat). All of the PCRs wererepeatedthreetimestoverifystrongsignalsobtainedineveryreaction where specific PCR fragment was generated. Primers (Table 1) were used in PCRs in 10 different combinations: LCO-1490/HCO-2198, LCO-1490/Chelicerate_R2, dgLCO-1490/dgHCO-2198, dgLCO-1490/Chelicerate_R2, C1-J-2123/C1-N-2776, C1-J-2183/C1-N-2776, CO1-J-1718/CO1-N-2735, LCO-1490/C1-N-2776, CO1- RCF1/CO1-N-2735, CO1-RCF1/CO1-RCR1. Samples were sequenced bidirec- tionally using Standard-Seq method (Macrogen). Sequence data were edited and assembled using Geneious Pro version 5.4 [36] and further handled in Mesquite version 2.74 [37]. Primer design In order to construct a new primer that would bind upstream of the C1-J-2183 primer binding site, we searched for the most conserved region in that area. We used the NCBI nucleotide search facility within Geneious Pro to gather all cox1 sequences of the order Araneae that contained the keyword ‘‘BARCODE’’. This search tagged sequences meeting all CBOL criteria [38]. All sequences longer or shorter than 658 bp were deleted and the remaining 1672 sequences, already aligned, were used for primer design (see Appendix S2). Potential primers were evaluated using the program Primer3 [39]. Results We optimized and improved the manufacturer’s protocol for extraction of genomic DNA using the MagMAX Express Magnetic Particle Processor, an automated high throughput DNA extraction system. We processed a wide range of spider tissue of different taxonomic affiliation, size and quality, to improve the protocol and increase the efficiency of the procedure. The manufacturer’s protocol only specifies the use of the kit with MagMAXExpress-96 Standard Magnetic Particle Processor or manually. Our procedure describes the use of the MagMAX Express Magnetic ParticleProcessor in combination with theMagMAX DNA Multi-Sample Kit. Additionally, we optimized the workflow for smaller quantities of starting material and accordingly adjusted and modified the internal program. Changes were made to the volume of reagents used and timing of specific steps (see Appendix S1). To assess the amplification success of ten primer pairs routinely employed for barcoding cox1 gene, we tested fifteen target species throughout the spider phylogeny [14,35] (Fig. 2; Table 2) and performed PCR reactions using ten primer pairs (Table 2). Our goal was to compare the performance of each primer pairagainsteveryrepresentativeacrossthetreeandevaluatetheirsuccessrate.The PLOSONE | DOI:10.1371/journal.pone.0113030 November21,2014 7/12 DNABarcodingandaNewcox1Primer Figure3.Gelimagesshowingdifferentsuccessratesincox1amplificationusingthetentestedprimerpairs. doi:10.1371/journal.pone.0113030.g003 success rate of different primer pairs varied from 30 to 100% (Fig. 3;Table 2). To target solely the short barcoding cox1 region, we recommend using the combination of Folmer primers (LCO1490/HCO2198) [33]. To maximize sequence data for genetic, genomic, and phylogenetic analyses, however, a longer stretch of cox1 is desired. Existing primers can fail to provide a continuous stretch if used in asingle pair or in combinations of pairs [12,31–32]. The forward primer C1-J-2183, for example, is designed too close to the reverse Figure4.ThenewprimerC1-J-2123bindingsiteis60bpupstreamoftheC1-J-2183bindingsite. doi:10.1371/journal.pone.0113030.g004 PLOSONE | DOI:10.1371/journal.pone.0113030 November21,2014 8/12 DNABarcodingandaNewcox1Primer Figure5.ThenewlyamplifiedandelongatedC1-J-2123/C1-N-2776sequenceoverlapswiththeFolmer(LCO1490/HCO2198)sequence. doi:10.1371/journal.pone.0113030.g005 HCO2198 for accurate chromatogram reads, and in practice the resulting interpretations of base pairs result in two partial cox1 sequences (Fig. 1). We therefore designed, via analysis of the consensus alignment of 1672 arachnid cox1 sequencesanewforwardDNAprimersituated60basepairsupstreamoftheC1-J- 2183bindingsite.ThesequenceGATCGAAATTTTAATACTTCTTTTTTTGAwas chosen as the most conserved and appropriate for the binding of a new primer, named C1-J-2123 (Fig. 4). Our preliminary tests (data not shown) suggest that this primer will work not only in spiders, but also other arachnids (scorpions, mites and ticks) and other invertebrates (bivalves, gastropods, tunicates and others). C1-J-2123performedwiththesamesuccessrate(93%)asthealternativeprimer C1-J-2183, amplifying in 14 out of 15 spider species (Fig. 3; Table 2). We recommend using the C1-J-2123/C1-N-2776 primer pair extended in upstream direction, which will allow for full overlap of this extended sequence with that obtained with the standard Folmer primers LCO1490 and HCO2198. Cox1 sequences obtained withthe C1-J-2123/C1-N-2776primer paircan fully sequence both regions (Fig. 5). Conclusions This study assessed the usefulness, measured as amplification success, of ten primer pairs routinely employed for targeting the barcoding and other cox1 gene regions in arachnids. Aiming to optimize the efforts in pursuing a longer stretch of cox1 that would maximize the data versus effort ratio for phylogenetic use of the barcode data, we sought an ideal protocol for automatic, reliable and fast extraction of genomic DNA, and developed a new cox1 primer for routine spider systematic work. Our newly designed cox1 primer C1-J-2123 replaces C1-J-2183 to avoid creating an indel region after the Folmer region. This may be especially useful to obtain more complete cox1 data for phylogenetic analyses. PLOSONE | DOI:10.1371/journal.pone.0113030 November21,2014 9/12 DNABarcodingandaNewcox1Primer We also improved the robotic DNA extraction protocol from the manufac- turer’s version, adapting it for spider tissue. We are the first to convey usage and set protocol for DNA extraction with MagMAX Express Magnetic Particle Processor in combination with MagMAX DNA Multi-Sample Kit. Our protocol allows for higher DNA concentration output compared with manual DNA extraction using commercial kits. It is thus suitable for semi-high throughput preparation of arachnid DNA. With the 1.5 hour DNA extraction run, the system can be loaded about 8 times per day providing DNA isolated from 192 samples. Following our protocol, PCR amplification of 96 samples is possible in only two hours using a single PCR program. Our protocol is fast and effective and able to provide up to 1000 amplifications per week. Using an even higher throughput system such as the MagMAX Express-96 Magnetic Particle Processor that processes 96 samples at a time, this time could be further cut in half. Supporting Information Appendix S1. Internal Program of MagMAX Express DNA Extraction Robot (Life Technologies) Protocol, modified. See separate file. doi:10.1371/journal.pone.0113030.s001 (DOCX) Appendix S2. Final DNA sequence assembly accession information. See separate file. doi:10.1371/journal.pone.0113030.s002 (DOCX) Acknowledgments We thank Ren-Chung Cheng, Gregor Guncˇar, Matjazˇ Gregoricˇ, Simona Kralj- Fisˇer, Klemen Cˇandek and Tjasˇa Lokovsˇek for their field and lab help, Miquel Arnedo for technical advice, and Ingi Agnarsson and Cor Vink for constructive reviews. Author Contributions Conceived and designed the experiments: NV NT MK. Performed the experiments: NV. Analyzed the data: NV MK. Contributed reagents/materials/ analysis tools: NV NT MK. Wrote the paper: NV NT MK. References 1. Hebert PDN, Cywinska A, Ball SL, DeWaard JR (2003) Biological identifications through DNA barcodes.ProceedingsoftheRoyalSocietyofLondonSeriesB-BiologicalSciences270:313–321. 2. HebertPDN,deWaardJR,LandryJF(2010)DNAbarcodesfor1/1000oftheanimalkingdom.Biology Letters6:359–362. 3. HebertPDN,deWaardJR,ZakharovEV,ProsserSWJ,SonesJE,etal.(2013)ADNA‘BarcodeBlitz’: RapidDigitizationandSequencingofaNaturalHistoryCollection.PlosOne8. PLOSONE | DOI:10.1371/journal.pone.0113030 November21,2014 10/12

See more

The list of books you might like