Logout succeed
Logout succeed. See you again!

Remnants of the Legume Ancestral Genome Preserved in Gene-Rich Regions PDF
Preview Remnants of the Legume Ancestral Genome Preserved in Gene-Rich Regions
PlantMolBiolRep(2015)33:84–101 DOI10.1007/s11105-014-0730-4 ORIGINALPAPER Remnants of the Legume Ancestral Genome Preserved in Gene-Rich Regions: Insights from Lupinus angustifolius Physical, Genetic, and Comparative Mapping MichałKsiążkiewicz&AndrzejZielezinski&KatarzynaWyrwa&AnnaSzczepaniak& SandraRychel&WojciechKarlowski&BogdanWolko&BarbaraNaganowska Publishedonline:15May2014 #TheAuthor(s)2014.ThisarticleispublishedwithopenaccessatSpringerlink.com Abstract The narrow-leafed lupin (Lupinus angustifolius) cajan)wereidentified.Thecomparativemappingofthetwo was recently considered as a legume reference species. Ge- largest lupin GRRs provides novel evidence for ancient du- netic resources have been developed, including a draft ge- plications in all of the studied species. These regions are nome sequence, linkage maps, nuclear DNA libraries, and conserved among representatives of the main clades of cytogenetic chromosome-specific landmarks. Here, we used Papilionoideae. Furthermore, despite the complex evolution acomplexapproach,involvingDNAfingerprinting,sequenc- of legumes, some segments of the nuclear genome were not ing,geneticmapping,andmolecularcytogenetics,tolocalize substantiallymodifiedandretainedtheirquasi-ancestralstruc- and analyze L. angustifolius gene-rich regions (GRRs). A tures.Cytogenetic markers anchoredinthese regions consti- L. angustifolius genomic bacterial artificial chromosome tuteaplatformforheterologousmappingoflegumegenomes. (BAC) library was screened with short sequence repeat (SSR)-based probes. Selected BACs were fingerprinted and Keywords Genome .Synteny.Sequencing .BAC-FISH . assembledintocontigs.BAC-endsequence(BES)annotation Molecularmarker.Narrow-leafedlupin allowedustochooseclonesforsequencing,targetingGRRs. Additionally, BESs were aligned to the scaffolds of the ge- nomesequence.Thegeneticmapwassupplementedwith35 Introduction BES-derived markers, distributed in 14 linkage groups and tagging 37 scaffolds. The identified GRRs had an average The legume family (Fabaceae) comprises about 19,500 spe- gene density of 19.6 genes/100 kb and physical-to-genetic cies from 750 genera, grouped into three subfamilies distance ratios of 11 to 109 kb/cM. Physical and genetic (Mimosoideae, Caesalpinioideae, and Papilionoideae). This mapping was supported by multi-BAC-fluorescence in situ familyisthemostremarkableforitswideevolutionarydiver- hybridization (FISH), and five new linkage groups were sification and cosmopolitan distribution. The genus Lupinus assigned to the chromosomes. Syntenic links to the genome belongstothePapilionoideaeandencompasses∼275species sequencesoffivelegumespecies(Medicagotruncatula,Gly- (Hughes and Eastwood 2006). Phylogenetic analyses based cinemax,Lotusjaponicus,Phaseolusvulgaris,andCajanus on nuclear internal transcribed spacer (ITS) and chloroplast (trnL-trnF, rbcL) DNA sequences classified the genus Electronicsupplementarymaterial Theonlineversionofthisarticle LupinusasadistinctlineagewithinthetribeGenisteae(sub- (doi:10.1007/s11105-014-0730-4)containssupplementarymaterial, tribeLupininae)(Aïnoucheetal.2004).Lupinusisbelievedto whichisavailabletoauthorizedusers. : : : : have diverged from the other legume genera ∼17 to 22.5 M.Książk:iewicz(*) K.Wyrwa A.Szczepaniak S.Rychel million years ago (Mya) (Lavin et al. 2005; Drummond B.Wolko B.Naganowska et al. 2012). Analyses of genetic similarity have identified DepartmentofGenomics,InstituteofPlantGeneticsofthePolish AcademyofSciences,Strzeszyńska34,60-479Poznan,Poland three centers of species diversity: North America, Central e-mail:[email protected] America,andAndeanSouthAmerica;AtlanticSouthAmer- : ica;and the Mediterranean and northernand eastern African A.Zielezinski W.Karlowski regions(AinoucheandBayer1999).Lupinspeciesaresepa- InstituteofMolecularBiologyandBiotechnology,Adam MickiewiczUniversity,Umultowska89,61-614Poznan,Poland rated into two major groups: the “Old World” and “New PlantMolBiolRep(2015)33:84–101 85 World” groups. The Old World group contains about 12–15 improved by the development of nuclear genome bacterial species; of them, three (including the narrow-leafed lupin, artificialchromosome(BAC)librariesfortwoL.angustifolius Lupinusangustifolius)havebeendomesticatedascrops.Lu- cultivars:Polishcv.Sonet(Kasprzaketal.2006)andAustra- pinspeciesarecultivatedworldwide,notjustforanimalfeed lian cv. Tanjil (Gao et al. 2011). The cv. Sonet BAC library andhumanconsumptionbutalsoasgreenmanureimproving contains55,296cloneswithanaverageinsertsizeof100kb, infertilesoil,duetotheirabilitytofixnitrogenthroughtheir representing approximately six haploid genome equivalents, symbioticrelationshipwithBradyrhizobia. Theyare popular whilethecv.TanjilBAClibrarycontains111,360BACswith fortheirhighseedproteincontents,lowalkaloidprofiles,and asimilaraverageinsertlength(12×genomecoverage).BAC- abilitiestoadapttoawiderangeofenvironmentalconditions. based molecular studies may be facilitated by cytogenetic Considerableprogresshas beenmaderecentlyinnarrow- analysis (i.e., fluorescent in situ hybridization with BAC leafedlupingenomics,andnewgeneticresourceshavebeen clonesasprobes;BAC-FISH),whichallowsDNAsequences developed. First, a microsatellite-anchored fragment length tobedirectlymappedtochromosomes.BAC-FISHhasbeen polymorphism (MFLP) method (Yang et al. 2001) was used largely exploited for locating genomic sequences in plants todevelopacomplexlinkagemap(Boersmaetal.2005),and with small genomes partitioned into tiny, similar chromo- several sets of molecular markers were linked to particular somes (Pedrosa et al. 2002; Fonsêca et al. 2010; Findley agronomictraits.Theseincludesoftseediness(markerMoLi) et al. 2010). Following the construction of the first (Lietal.2012),reducedpodshattering(TaLi,LeM1,LeM2) L. angustifolius BAC library (Kasprzak et al. 2006), BAC- (Boersma et al. 2007b; Li et al. 2010), early flowering FISH was used to perform cytogenetic mapping of the (KuHM1) (Boersmaetal.2007a),andresistancestovarious narrow-leafedlupingenome;thisstudyfocusedonassociating fungal diseases, including anthracnose (AntjM1, AntjM2) linkagegroupswiththecorrespondingchromosomes,withthe (Yang et al. 2004, 2008; You et al. 2005), phomopsis stem goal of integrating the genetic and cytogenetic maps of blight (PhtjM1, PhtjM2, Ph258M1, Ph258M2) (Yang et al. L. angustifolius (Kaczmarek et al. 2009; Lesniewska et al. 2002),andlupinrust(RustM1,RustM2)(Sweetinghametal. 2011). BAC-FISH has also been used to validate and verify 2005). Moreover, a linkage map with gene-based sequence- BAC-basedDNAfingerprinting(Książkiewiczetal.2013). tagged site (STS) markers was constructed (Nelson et al. As mentioned, many of the available L. angustifolius 2006), as was a consensus map containing both MFLP and markers were obtained by DNA fingerprinting approaches STSmarkers(Nelsonetal.2010).Thedevelopmentofnext- basedonMFLPs(Yangetal.2001).Thesesequencescontain generationsequencing(NGS)technologieshasfacilitatedthe short sequence repeat (SSR) motifs, predominantly TTG, low-cost production of large volumes of genomic and GTT,andGA.AcomprehensiveanalysisofSSRdistribution transcriptomic sequences. Transcriptome data have been re- in the genome of the model legume, M. truncatula, showed leased for two lupin species, Lupinus albus and Lupinus that the majority of SSRs are located in the non-transcribed luteus.Thefirstwhitelupingeneindex(LAGI1.0)contained fractions ofgene-rich regions (GRRs) or within the untrans- 125,821uniquesequenceswithanaveragelengthof1,155bp lated portions of transcripts (Mun et al. 2006). The first (O’Rourkeetal.2013),whiletheyellowlupintranscriptome attemptstoscreenthe narrow-leafed lupin BAC library with surveyyieldedanassemblyof55,309isotigsand8,741full- MFLP-derivedmarkersyieldednumerouspositivehybridiza- length proteins (Parra-González et al. 2012). NGS was also tion signals. However, cytological localization studies re- appliedtoL.angustifolius,whereresearchersdevelopednew vealed that the isolated BAC clones localized to different sets of STS markers linked to selected hypothetical genes, chromosomes, indicating that such probes are not useful for suchasthosebelievedtoconferanthracnoseresistance(Yang positionalcloningofparticulargenes(Lesniewskaetal.2011; etal.2012)andPhomopsisstemblightresistance(Yangetal. Książkiewiczetal.2013).Incontrast,probesbasedonMFLP- 2013a). A draft assemblyof the lupin genomewas obtained derivedmarkershavebeenshowntoserveasanchorpointsfor fromawhole-genomeshotgunsequencingapproach,offering tagging of GRRs containing particular SSR motifs; such 26.9× coverage (Yang et al. 2013b). More genes have been markers have been proven useful for identifying GRRs in identified in lupin than in other legume species (e.g., the narrow-leafed lupin genome and have aided in general L.japonicus,Medicagotruncatula,Glycinemax,andCajanus genomic and syntenic studies of the species (Książkiewicz cajan), perhaps reflecting additional round(s) of whole- etal.2013). genome duplication in the lineage leading to Lupinus as Here,weselectednarrow-leafedlupinGRRsfromaBAC evidenced from previous studies on chromosome number, librarybyhybridizationwithfourMFLP-derivedmarkersand transcriptome analysis, and preliminary genome annotation used diverse molecular methods (e.g., DNA fingerprinting, (Naganowska et al. 2003; Parra-González et al. 2012; BAC-FISH,andgeneticmapping)tocharacterizethestructure O’Rourkeetal.2013;Yangetal.2013b). and organization of these regions of the L. angustifolius ge- Theopportunitiesforphysicalgenomemapping,positional nome. Furthermore, we comprehensively annotated the se- gene cloning, and sequencing have been significantly quences of selected GRRs and confirmed the results by 86 PlantMolBiolRep(2015)33:84–101 comparativemappingtogeneindexesofL.albusandL.luteus selection,andDNAisolationwerecarriedoutasprevious- and expressed sequence tag (EST) databases of Fabaceae, ly described (Książkiewicz et al. 2013). Glycinespp.,Lotusspp.,Medicagospp.,andPhaseolusspp. Finally,weidentifiedsyntenicandhomologouslinksbetween L. angustifolius and five sequenced legume species SequencingofBACEnds representing diverse clades: M. truncatula, G. max, Lotus japonicus,Phaseolusvulgaris,andC.cajan. A PhasePrep BAC DNA Kit (Sigma) was used to isolate bacterialDNA,andtheBACendsweresequencedusingthe following pIndigoBAC5 (Epicentre, Illumina) sequencing primers: 5′ end, CTCGTATGTTGTGTGGAATTGTGAGC, MaterialsandMethods and 3′ end, GGATGTGCTGCAAGGCGATTAAGTTGG. ChromasLite2.01(TechnelysiumPtyLtd)wasusedtoverify HybridizationProbesandBACLibraryScreening the chromatograms and identify mis-call sequencing errors. TheBAC-endsequences(BESs)obtainedusingthe3′and5′ Thehybridizationprobeswerebasedonthesequencesofthe primersweregiventhe“_3”and“_5”suffixes,respectively. MFLP-derivedgeneticmarkers,AntjM1,AntjM2(Yangetal. 2004; You et al. 2005), Ph258M2 (Yang et al. 2002), and RustM1 (Sweetingham et al. 2005) (Hua’an Yang, unpub- RestrictionFingerprintingandContigAssembly lished). The PCR primers for probe amplification were de- signed to match the appropriate SSR motifs. The probe se- Two units of Eco130I and HindIII were separately used to quences were tested for the presence of repetitive elements digest 1 μg of BAC DNA at 37 °C for 16 h. The digestion (BLASTN)andprotein-codingregions(BLASTX),withthee products were separated by 1 % agarose gel electrophoresis valuecutoffssetto10−11.TheBLASTNalgorithmwasopti- (24 h, 3 V/cm, 8 °C) and visualized by ethidium bromide mizedforsomewhatsimilarsequences(wordsize,11;match/ staining.Normalizedbandpositionfilesweregeneratedusing mismatch scores, 2/−3; and gap existence/extension costs, theImage3.10bgelprocessingprogram(Sulstonetal.1989). 5/2).ThefollowingparameterswereappliedtotheBLASTX Products derived from the vector DNAwere removed, and algorithm: word size, 3; matrix, BLOSUM 62; and gap BAC contigs were assembled using FingerPrinted Contigs existence/extensioncosts,11/1.AllprobeswerePCRampli- version 8.5.3 (Soderlund et al. 1997), with the following fiedusingL.angustifoliusgenomicDNAasthetemplate.The parameters: cutoff 1e-11 and tolerance 3. Additionally, resultingPCRproductswerepurified(QIAquickPCRPurifi- Sequencher4.7(GeneCodes)wasusedtoalignBESstotag cationKit;Qiagen),sequencedtoconfirmlocus-specificam- clonesthatoverlappedattheirends.Furthermore,BESswere plification(ABIPRISM3130XLGeneticAnalyzer;Applied used to screen the L. angustifolius whole-genome shotgun Biosystems,Hitachi),andradiolabeledbyrandompriming contigcollectiondepositedinNCBIsequencedatabase(Pro- (HexaLabelDNALabelingKit;Fermentas)inthepresence ject No. PRJNA179231; assembly version of 50 μCi [α-32P]-dCTP. The probe sizes, primer se- GCA_000338175.1; subsequent sequence accessions, quences, and SSR loci identified in the probe sequences AOCW01000001toAOCW01191454).Asequenceidentity are given in Table 1. High-densityDNAmacroarrays con- cutoffvalueof99%wasapplied,andtheBLASTalgorithm taining clones from the L. angustifolius nuclear genome was optimized for highly similar sequences (word size, 28; BAC library were prepared (GeneTAC G3; Genomics So- match/mismatchscores,1/−2;andgapcosts,linear).Iftwoor lutions) on Hybond N+ 22.2×22.2-cm nylon filters (AP moreBESswerelocalizedtoasinglescaffold,theappropriate Biotech, Little Chalfont, UK). Probe hybridization, clone BACcloneswereconsideredtophysicallyoverlap. Table1 Thesizesandsequences ofthelibraryscreeningprobes, Probe SSRlocus PCRprimers Probesize PCRprimers,andSSRlociiden- tifiedintheprobesequences AntjM1 (TTG)6 CCCATTGTTGTTGTTG 276 CATCCTCACATATGAAGC AntjM2 (GA)(N) (GA)(N) (GA) GTATCTGATGACAATTAGTCAC 429 2 n 2 n 2 TCATCTCTAAATCCTATCTCAG Ph258M2 (GTT) GGGAACAACAACAACAACAAC 240 6 GTAGTGACTGAAGAAACTTACAC RustM1 (TTC) (TTG) TAACATTCCTACCTTCTT 280 3 3 AACACTAGTGCTTCAAAAA PlantMolBiolRep(2015)33:84–101 87 FunctionalAnnotation G. max (Schmutz et al. 2010) (JGI v1.1 unmasked, http:// www.phytozome.net), P. vulgaris (v0.9, DOE-JGI and Thefunctionalannotationsofthegeneticelementsencodedin USDA-NIFA, http://www.phytozome.net), and C. cajan BACs and BESs included de novo detection of specific sig- (Varshneyetal.2012)(projectPRJNA72815,v1.0).Sequence nals and comparative analyses with known sequences, as similarity analyses were performed using the CoGe BLAST applied using a CEL analysis pipeline specifically designed algorithm(Lyonsetal.2008)withthefollowingparameters:e for gene discovery and comparative genome research value cutoff, 1e-20; word size, 8; gap existence cost, 5; gap (Zielezinskietal.2012).Priortogeneprediction,transposable elongationcost,2;nucleotidematchscore,1;andnucleotide element-related repeats were annotated and masked using mismatchscore,−2.Syntenicblockswerevisualizedusingthe RepeatMasker 4.0.3 (http://www.repeatmasker.org) and the Web-based Genome Synteny Viewer (Revanna et al. 2011) RepBase 17.11 library (Jurka et al. 2005). Custom Python andCircos(Krzywinskietal.2009). scriptswerewrittentoidentifysimpletandemrepeats(1–6bp inlength).Wedidnotmasksimplerepeatsormicrosatellites. GeneticMapping In silico gene prediction was performed using Fgenesh (Salamov and Solovyev 2000) and Augustus (Stanke and AnnotatedBESandBACsequenceswereusedtodesignPCR Morgenstern 2005). Sequences were subjected to sequence primers for amplification of DNA isolated from the parental homology searches against the transcriptome sequences of linesoftheL.angustifoliusmappingpopulation:83A:476(D) yellow lupin (L. luteus) young leaves, buds, flowers, and and P27255 (W). When primers yielded single products, seeds(Parra-Gonzálezetal.2012)andwhitelupin(L.albus) amplicons were recovered directly from the post-reaction rootsandleaves(O’Rourkeetal.2013).Thefollowingrepos- mixtures (QIAquick PCR Purification Kit; Qiagen). When itorieswereselectedtodownloadthesequencedata:L.luteus, twoormorePCRproductswereobtainedfromaprimerpair, http://www.cgna.cl/lupinus(projectPRJNA170318,sequence the relevant DNA bands were excised from the gel and ex- read archive SRX159101); L. albus, http://comparative- tracted (QIAquick Gel Extraction Kit; Qiagen). Purified legumes.org (gene index LAGI 1.0). For each BAC/BES, amplicons were sequenced. Length polymorphisms were vi- ESTsandcDNAswith95%identitywereobtainedfromthe sualized by 1 % agarose gel electrophoresis, and nucleotide rawtranscriptomedataofL.albusandL.luteusandfromEST substitution polymorphisms were detected by the Cleaved collections representing Fabaceae, Glycine spp., Lotus spp., Amplified Polymorphic Sequence (CAPS) or derived CAPS Medicagospp.,andPhaseolusspp.TheESTcollectionswere (dCAPS) approaches. Restriction sites were identified using screened for vector sequences using cross_match from the dCAPS Finder 2.0 (Neff et al. 2002). Restriction products Phredpackage(Ewingetal.1998),andvectorandlowquality were separated by 1–3 % agarose gel electrophoresis, with sequencesweretrimmedusingtheNCBIUniVecdatabaseas theagaroseconcentrationadjustedaccordingtothesizeofthe a reference (“FTP site for UniVec,” n.d.). The cleaned reads expected digestion products. The mapping population were initially assembled using CAP3 (Huang and Madan consistedof90recombinantinbredlines(F )(kindlyprovided 8 1999), and the EstScan program (Iseli et al. 1999) was used by Dr. Hua’an Yang, Department of Agriculture and Food, to scan the EST contigs for potential frameshift errors by Western Australia). The new markers were localized on the detecting irregularities in the coding potential. EST/cDNA L. angustifolius geneticmap (Nelson etal. 2010)alongwith contigs were mapped to the genome sequence using the the previously reported markers (Książkiewicz et al. 2013). Sim4 program (Florea et al. 1998). BLASTX was used to Linkage mapping was done in Map Manager QTXb20 examine similarities with curated plant proteins in the (Manly et al. 2001). Graphic illustration of linkage groups SwissProtandRefSeqdatabases,aswellaspredictedproteins wasperformedusingMapChart(Voorrips2002). in trEMBL. For the potential genes, gene prediction models were visualized, manually verified, and refined using the PCRConditions Apollo Genome Annotation and Curation Tool 1.11.7 (Lewisetal.2002). The primers were designed using Primer3Plus (Untergasser et al. 2007). Each PCR reaction was performed in a total MicrosyntenyAnalysis volumeof20μlin96-welltwin.tecPCRplates(Eppendorf) using0.5UTaqDNAPolymeraseRecombinant(Invitrogen), BACsequencesweremaskedforrepetitivecontentsandlow- 1×PCRbuffer,2mMMg2+,0.25mMdNTP,0.25μMeach complexityregionsandthensubjectedtosequencehomology primer, 50 ng DNA template, and deionized water. The am- searches against the following genome sequences: plification protocol included an initial denaturation at 94 °C M. truncatula (Young et al. 2011) (strain A17, JCVI v3.5.4 for4min,followedby35cyclesofannealing(45–62°Cfor unmasked, http://www.jcvi.org/medicago/), L. japonicus 30s),elongation(72°Cfor40s)anddenaturation(94°Cfor (Sato et al. 2008) (v2.5 unmasked, http://www.kazusa.or.jp), 30s),andafinalelongationstep(72°Cfor6min). 88 PlantMolBiolRep(2015)33:84–101 BAC-FISH Table 2 Nucleotide and protein accessions identified in the designed hybridizationprobes DNA was isolated from single Escherichia coli colonies Probe Identifiedsequence Evalue (QIAprep Spin Miniprep Kit; Qiagen) (Farrar and Donnison 2007), labeled with digoxygenin-11-dUTP and/or AntjM1 AC225502.9,M.truncatulaclonemth2-58c24 2e-22 tetramethylrhodamine-5-dUTP (Roche Diagnostics) by nick Ph258M2 AY830921.1,PisumsativumCONSTANS-like 1e-37 translation,and usedasmolecular probesfor BAC-FISH. In RustM1 AC147007.17,M.truncatulaclonemth2-26c3 2e-53 some cases, two or three BAC clones were simultaneously analyzed in various combinations (multi-BAC-FISH). These All of the selected BAC clones were end-sequenced. Se- studieswerecarriedoutonmitoticmetaphasechromosomes. quencingfromthe5′end failedforclones024B21,024F17, Cytological preparations were made from root meristematic 042B18,and114F10,whereasthatfromthe3′endfailedfor tissues, as previously described (Lesniewska et al. 2011). clone140L16.Weobtained243BESswithanaverageinsert Slide quality was controlled by observation under a phase- lengthof665bp;theyhavebeendepositedasGenomeSurvey contrastmicroscope(BX41;Olympus).FISHwasperformed Sequences in the DNA Data Bank of Japan (DDBJ; acces- according to the protocol previously adapted for use in sions AB809166 to AB809361) and in GenBank at the Na- L. angustifolius (Lesniewska etal. 2011; Książkiewicz et al. tional Center for Biotechnology Information (NCBI; acces- 2013).DigoxygenatedDNAprobesweredetectedwithFITC- sionsHR864171toHR864217). conjugatedantidigoxigeninprimaryantibodies(RocheDiag- nostics). Chromosomes were counterstained with 2 μg/ml 4',6-diamidino-2-phenylindole(DAPI)(Sigma)inVectashield PhysicalMappingofBACClones antifademountingmedium(VectorLaboratories,Burlingame, CA).PreparationswereexaminedunderaBX60microscope Toexaminetheirputativeclusteringinthelupingenome,the (Olympus)usingtheCell_Fsoftware(Olympus).Theimages BAC clones were subjected to restriction enzyme DNA fin- were captured using a CCD monochromatic camera and gerprinting.Initially,DNAisolatedfromfiveBACcloneswas superimposedusingMicrografxPicturePublisher8software digested separately with VspI, BshI, Eco130I, AcyI, BamHI, (Corel). XbaI, XhoI, and HindIII and double-digested with XbaI and XhoI.Fromthis,weselectedtwoenzymesthateachgenerated 20–40 products (Eco130I and HindIII) and used them to ResultsandDiscussion fingerprint the entire set of BAC clones. The FingerPrinted Contigs (FPC) assembly procedure utilized in the present BACLibraryScreening workdependsmainlyontwoparameters:toleranceandcutoff. Thesevariablesandtheiradjustmentmethodsweredescribed Hybridization probesweredeveloped fromthe sequences of in a previous methodology paper (Soderlund et al. 1997); fourMFLP-derivedmarkerscontainingparticularSSRmotifs here,weusedatoleranceof3andacutoffof10–11.Analogous (AntjM1,AntjM2,Ph258M2,andRustM1)(Yangetal.2002, agarose gel-based approaches for contig construction used 2004; Sweetingham et al. 2005; You et al. 2005) (Hua’an values ranging from 3 to 7 for tolerance and 10−8 to 10−16 Yang, unpublished) and used to screen the genomic BAC forcutoff(Marraetal.1997;Chenetal.2002;Ngetal.2005). library of L. angustifolius cv. Sonet (Table 1). BLASTwas Based on the restriction patterns, we constructed 14 contigs usedtotesttheprobesequencesforthepresenceofrepetitive containing a total of 97 clones, whereas 27 clones failed to elements and protein-coding regions. Several alignments to groupandweredesignatedassingletons.Contig1,whichwas M.truncatulagenomicsequenceswereidentifiedinAntjM1 and RustM1, while Ph258M2 was found to contain a se- Table3 Thenumberofpositivesignalsobtainedafterprobehybridiza- quence similar to the Pisum sativum CONSTANS-like gene tionoftheBAClibrary (Table 2). The hybridization yielded numerous positive sig- AntjM1 AntjM2 Ph258M2 RustM1 nals,and a totalof124 BACcloneswereselected. The vast majorityofclonesdisplayedhybridizationsignalsjointlywith Totalsignals 64 115 108 105 twoormoreprobes,whereasrelativelyfewhybridizedexclu- Uniquesignals 0 1 1 3 sively to one probe (Table 3). The underlying cause of this Jointsignals 60a 94b substantialcross-hybridizationcouldbethepresenceofanal- Jointsignals 46c ogousrepeatsinprobesequences,like(TTG) inAntjM1and 6 (GTT) in Ph258M2. However, it does not explain the phe- aanumberofsignalssharedbyAntjM1andAntjM2probes 6 nomenon of cross-hybridization to AnjtM2 marker, carrying banumberofsignalssharedbyPh258M2andRustM1probes differentrepeats,namely(GA)n. canumberofpositivesignalsjointforallappliedprobes PlantMolBiolRep(2015)33:84–101 89 visualizedby9“Q”cloneswithunclearcontigpositions,was foundtosufferfrominstability.AdisproportionatenumberofQ clonesmightreflectimproperassemblyofrepetitivesequences (Katagirietal.2005).Calculationsbasedonrestrictionproduct sizes and previous pulsed field gel electrophoresis (PFGE) results (Lesniewska et al. 2011) enabled us to estimate the physicallengthofFPC“consensusband”as3.0kb. Furthermore,toidentifyBACclonesthatoverlappeddirectly attheirends,comparativeanalysisofBESswasperformed.This approachentirelyconfirmedthegroupingof32clonesinto10 contigs. Next, we used BLASTN to align all of the BESs to L. angustifolius whole-genome shotgun contigs and identified correspondingscaffoldsfor121BESs.Theseassignmentswere Fig.1 Percentage BEScoverage of EST, SwissProt, and trEMBLse- quencealignments.CodingDNASequences(CDSs)identifiedinBESs very specific under the utilized cutoff and BLASTalgorithm wereannotatedusingrepeatelementcollectionsandclassifiedasrepeti- parameters.NoBESlocalizedtomorethanonescaffold,while tiveornon-repetitive.TheBES-derivedCDSswerethenalignedtothe six scaffolds harbored BESs originating from two or more indicatedsequencedatabases,andthepercentcoveragewascalculated clones.Furthermore,ouranalysisshowedthat11BACsphys- icallyoverlappedinfivecontigs(datanotshown). wereobtainedonlyforthelupintranscriptomedataofL.albus (87.7%)andL.luteus(49.7%),whileFabaceaeESThitswere FunctionalAnnotationofBAC-EndSequences identifiedfor11.9%ofthegene-codingBESs.DetailedBES annotation data, including sequence coordinates, alignment ThegeneratedBEScollection(161,697bpintotal)wassub- quality e values, ID numbers, and accessions, are given in jectedtoinsilicoannotationofvariousgeneticelements.Our OnlineResource1. initial analysis identified 38.3 % of the BESs as repetitive sequences;ofthem,58.7%wereretrotransposonsand11.4% BACCloneSequencing were transposons. The first group of transposable elements (TEs) included predominantly Ty1/Copia (63.1 %) and Ty3/ BACcloneswereselectedforwhole-insertsequencingbased Gypsy (25.1 %), whereas the second subset (the transposon ontheirBESannotationstotarget-gene-rich(fourclones)and group) was represented mainly by hAT (77.9 %) and CMC- repetitive(oneclone)regionsofgenomeandincludedclones EnSpm(20.2 %). Inadditiontothe TEs,the BEScollection 017B07 (5′ end, callose synthase; 3′ end, ABC transporter), containeda“repetitive”subsetthatconsistedofsimplerepeats 075D16(5′end,Nudixhydrolase;3′end,hemeoxygenase), (26.9%)andrRNA(3.11%).OnlineResource1containsdata 112N18 (5′ end, ABC transporter; 3′ end, ethanolamine ki- ontheRepeatMaskerandRepbaseannotations,alongwiththe nase), 119M23 (5′ end, transposon CMC-EnSpm; 3′ end, relevant sequence coordinates and alignment scores. During retrotransposon Ty1/Copia), and 136B16 (5′ end, very-long- thesecondstepofannotation,weidentifiedseveralsequences chain fatty acid condensing enzyme; 3′ end, alpha-tubulin). withsimilaritiestoknowngenesencodingperoxidases,Nudix Next-generation sequencing (454) allowed us to construct hydrolase,senescence-associatedproteins,cytochromeb5re- three contigs for 017B07 (109,008 bp), eight for 075D16 ductase,tubulins,callosesynthase,tetraspanin,pathogenesis- (98,086 bp), three each for 112N18 and 119M23 (43,842 related proteins, multidrug resistance proteins, lectin, and and 97,240 bp), and four for 136B16 (103,792 bp). The leghemoglobin.Ingeneral,27.3%oftotalBEScontentwas contigscorrespondingtoBACclones017B17,112N18,and annotatedasgene-coding. 119M23wereorderedandorientedaccordingtotheresultsof The BESs were also aligned to recently published tran- our BES alignments and PCR amplification with contig- scriptome data from L. albus and L. luteus; the ESTs of derivedprimers.Forclones075D16and136B16,onlyBES- Fabaceae,Glycine,Lotus,Lupinus,Medicago,andPhaseolus; containingexternalcontigswereorderedandoriented. andtheViridiplantaeSwissProtandtrEMBLdatabases(Fig.1). InthefractionofBESsassignedtotheTEsubgroup,thehighest alignment coverages were observed for the transcriptomes of BACCloneAnnotation L.albus(84.6%)andL.luteus(74.0%)andforViridiplantae trEMBL(71.3%).SequencesfromFabaceaedbESTGenBank Annotation revealed that the frequencies of interspersed re- database produced alignments for 42.2 % of the TE-assigned peats (not including SSRs) in the sequenced BACs varied BESs,withthehighestcoveragesnotedfortheESTsofGlycine from 1.1 % in clone 017B07 to 37.7 % in clone 119M23 (23.3%),Phaseolus(21.9%),andMedicago(19.1%).Among (Table4).Weobservedahighprevalenceofretrotransposons, thenon-repetitivegene-codingBESs,highalignmentcoverages particularly Ty1/Copia. Transposon occupancy was 90 PlantMolBiolRep(2015)33:84–101 Table4 SummaryoftheBES,BAC,andscaffoldsequenceannotations Sequence BES 017B07 075D16 112N18 119M23 136B16 Scaffold Total DNA/EnSpm 0.88a – – – 0.82 – 0.09 0.18 DNA/hAT 3.39 – 1.95 – – 0.64 0.04 0.46 DNA/Helitron 0.08 – – – – – 0.19 0.13 DNA/other – – – – – – 0.21 0.14 LTR/Copia 14.15 0.08 22.00 6.90 36.85 14.83 11.73 13.18 LTR/Gypsy 5.62 0.35 1.73 10.94 – 7.94 7.15 6.09 LTR/other 0.03 – – – – – 0.22 0.15 Non-LTR/SINE – 0.11 – – – – – 0.01 Non-LTR/LINE 1.93 – – – – – 1.28 1.02 Non-LTR/RTE 0.70 0.56 0.07 – – 0.64 0.39 0.39 rRNA 1.19 – – – – – 0.39 0.36 Simplerepeat 10.28 13.80 12.21 15.51 12.13 13.24 9.72 10.60 Totalrepeats 38.25 14.90 37.96 33.35 49.80 37.29 31.41 32.71 TotalgenesEST-confirmednon-repetitive 27.30 64.39 2.67 14.16 – 16.81 18.66 20.07 – no alignment was found, DNA class II TEs (transposons), LTR class I TEs (retrotransposons) with long terminal repeats, non-LTR class I TEs (retrotransposons)lackinglongterminalrepeats aPercentageofsequencecoveredbyalignmentstoparticularelements negligible, and theoccupiedsequences consistedofjusttwo ReferencetotheDraftLupinGenomeAssembly families,hATandCMC-EnSpm. InthefivesequencedBACclones,weidentifiedatotalof BESswerealignedtothescaffoldsandcontigsofthenarrow- 30 genes thatwere not related torepetitive elements. A pre- leafedlupingenomedraftsequence(Yangetal.2013b),where dominance of non-repetitive, EST-confirmed genes was ob- theytagged114sequencesintotal(OnlineResource3).The served in clone 017B07 (64.4 %). This clone represents a orientations of 74 scaffolds were identified by paired BESs. GRR with an estimated gene density of 19.3 genes/100 kb. Thelengthsofthescaffoldsvariedfrom646to74,051bp.The Clones 112N18 and 136B16 showed moderate coverage by sequencesof55scaffoldslongerthan10kb(1,241,568bpin gene-coding sequences (14.2 and 16.8%,respectively).Our total)werefunctionallyannotatedtosupplementtheinforma- analysis of lupin transcriptome data identified statistically tion obtained from our analysis of BESs and BACs. On significantalignmentsforall30genesinL.albusandfor28 average,21.7%ofthescaffoldsequenceswereannotatedas genesinL.luteus.EST-NCBIandUnigenerepresentatives TEs; however, this value varied considerably by scaffold were identified for all of the annotated genes. The con- (from0to53.7%).AsobservedintheBESsandBACs,retro structed alignments covered 90.1 % of the hypothetical gene transcript lengths on average (95.4 % in L. luteus, S 100 88.4 % in L. albus, 85.9 % in EST-NCBI, and 90.8 % in D C 90 Unigene) (Fig. 2). Comparison of annotated gene se- o s t 80 quences to selected reference accessions allowed us to ent 70 m perform in silico translation of the complete protein se- n 60 g quencesfor14genesandpartialproteinsequences(>50% y ali 50 of the reference sequence length) for another eight genes. e b 40 ag 30 Detailed data on the BAC annotation, including predicted ver 20 o genes, ESTs (L. albus, L. luteus, NCBI in general), % c 10 Unigene coverage, proteincoverage,reference accessions, 0 L. albus L. luteus EST Unigene gene coordinates, exon coordinates, and sequences are transcriptome transcriptome shown in Online Resource 2. The BAC clone sequences non-repetitive CDS repetitive CDS and their annotation data have been stored in the High Fig.2 PercentageBACcoverageofESTandUnigenesequencealign- ments.CDSsidentifiedinBACsequenceswereannotatedusingrepeat ThroughputGenomicSequencesDivisionoftheEuropean element collections and classified as repetitive or non-repetitive. The Molecular Biology Laboratory under project PRJEB1600 BAC-derived CDSswere thenalignedto the indicated sequencedata- (accessions HF937076 to HF937080). bases,andthepercentcoveragewascalculated PlantMolBiolRep(2015)33:84–101 91 elementswerethemostabundant,representedmainlybythe the trinucleotiderepeats wereAAT.The other majorclusters Copia and Gypsy subclasses, followed by LINEs and RTEs of di- and trinucleotide repeats corresponded to AG, AAC, (Table4).Thetransposonclasswasmainlyrepresentedbythe and AAG; these included the SSRs harbored within the de- Helitron, CMC-EnSpm, and (rarely) hAT groups. The func- signed probe sequences (TTG, TTC, GA). The analysis of tional annotation of BAC-end sequences and adjacent scaf- BAC sequencesandpaired-endscaffoldsrevealedthatsome foldsofthecontig1revealedalargesubsetoftransposonand BACs contained SSRs of two or more probe sequences. It retrotransposon elements. The presence of such repetitive could be the reason of cross-hybridization between probes sequences may explain the incorrect assembly of pseudo- carryingnon-analogousrepeats.Tetranucleotideswererepre- contig1. sentedmainlybyrepeatscontainingoneC/Gnucleotideand BAC and scaffold sequences with unmasked repetitive threeA/Tnucleotides(Table5).ThefrequencyofSSRsinthe elements were aligned to the genome sequences of five le- analyzed sequences was much higher than that previously gumespecies(M.truncatula,G.max,L.japonicus,P.vulgaris, observed among randomly selected BESs (Gao et al. 2011). and C. cajan) to determine the expansion profiles of such ThisindicatesthattheuseofSSR-anchoredprobesallowedus sequencesinthePapilionoidclades.Severaltypesofdistribu- toeffectivelytargetregionsofthelupingenomethatcontained tionpatternswereidentified,showingspecies-specificdiffer- such sequences. In general, SSRs (except for mononucleo- ences in the presence and abundance of particular repeats tides and ATdinucleotides)are locatedinGRRs (Munetal. (Online Resource 4). The most common pattern, obtained 2006).Inrice,dinucleotiderepeatsof(GA) usuallyoccurin n for35%ofCopiaand38%ofGypsyelements,wasafairly gene-flanking regions and do not appear to be commonly ubiquitous distribution of alignments across numerous chro- associated with transposable elements (Temnykh et al. mosomes in all tested species. The second most frequent 2001). Mining of Brassica rapa ESTs revealed that (GA) n pattern, which was observed for 20 % of Copia elements and (AG) repeats comprise 13.3 % of all EST-SSRs n (butnoGypsyelement),wasthepresenceofnumerousalign- (Ramchiaryetal.2011),whereasthemajorityoftrinucleotide ments in the genome of G. max, with few or no copies repeatsinthegene-codingregionsoftheArabidopsisgenome observed in the other species. In the remaining cases, we were found to be AT-rich (Cardle et al. 2000). The in silico observed numerous alignments to two to four species; this mapping of (GTT) microsatellites in the soybean identified n wasfrequentlyseenforCopiaandGypsyelements,aswellas 32siteslocatedinhigh-gene-densityregionsbutonlyonesite forlessabundantrepeats,suchashAT,Harbinger,RTE1,and inagene-freeregion(Belarminoetal.2012).Ourresultsare LINErepeats.Assessmentoftherepeatsequencedistribution consistentwiththoseoftheearlierstudies,asthemajorityof within legume genomes revealed that 99 % of the analyzed SSR loci identified in this survey were localized in regions lupinrepeatsyieldedalignmentsintheG.maxgenome,76% withgenedensitieshigherthan10genes/100kb. in C. cajan, 68 % in P. vulgaris, 57 % in L. japonicus, and 51 % in M. truncatula. These differences indicate that the Table 5 Percentage of simple repeats identified in the analyzed sequence-level conservation of interspersed repeats is some- sequences what higher between Lupinus and the Phaseoleae than be- Type Percentage Type Percentage tweenLupinusandrepresentativeLoteaeorTrifoliae. The in silico detection of coding regions in scaffolds re- Mononucleotide 94.93a Tetranucleotide 0.13 vealedatotalof289genes.Comparisonstorepeatsequences A/T 91.44b AATG 29.63 invariousdatabasesallowedusetoidentify153non-repetitive C/G 8.56 AAAG 16.67 genesamongthem.Theaveragegenedensitywas8.2genes/ Dinucleotide 2.45 ATAC 14.81 100kbofsequence.Asmanyas18scaffoldswereclassified AT 49.55 AACT 14.81 asGRRs,withgenedensities>15genes/100kb(rangefrom AG 30.60 AATA 12.96 15.5 to 31.8 genes/100 kb). The annotation data for the AC 19.85 AATT 11.11 scaffoldsarepresentedinOnlineResource5. Trinucleotide 2.38 Other 19.40 AAT 55.96 Pentanucleotide 0.01 SimpleRepeats AGG 12.04 Hexanucleotide 0.10 AAC 11.92 AGGATG 50.58 Allsequencesgeneratedinthestudyandthescaffoldscarry- AAG 11.88 AGGAAG 30.65 ing the selected BESs (1,855,233 bp intotal) were analyzed ATG 6.28 Other 12.67 forthepresenceofSSRs.Repeatsdifferingbyreadingframes Other 1.92 (e.g.,AGvs.GA)orreverse-complementreadingwereclus- tered.Themostfrequentweremononucleotidetracts,inwhich Boldfontindicatespercentfrequenciesofmaingroupsofrepeats A/Twas10-foldmorecommonthanC/G.Approximatelyhalf aPercentfrequencyofSSRtype ofthedinucleotiderepeatswereAT,whilemorethanhalfof bPercentfrequencyofSSRsubgroupwithintheparticularSSRtype 92 PlantMolBiolRep(2015)33:84–101 BAC-FISH repetitive content allowance) and their BAC-FISH signal patterns. Fluorescent in situ hybridization was used to support our Clones that yielded single-locus signals were used for physical and genetic mapping of the BAC clones. Initially, multi-BAC-FISH, a comprehensive cytogenetic analysis in weusedtheresultsofourcontigassemblyandBESannota- which differently labeled clones are concurrently applied to tion to select clones for cytogenetic analysis. The initial thesamechromosomeslide(Table6).Weusedmitoticchro- contig-representing BACs yielded repetitive BAC-FISH sig- mosomes,despitethelimitedaxialresolutionandhighmini- nals dispersed over numerous chromosomes, so we further malprobesizerequirementsofthistechnique,becausetheaim analyzedotheroverlappingclones.Wesubjectedatotalof83 was to localize the clones to individual chromosomes. Fur- BACs (including 30 singletons) to cytogenetic analysis. By thermore, thisstrategyallowed us toperform internalcontig comparison to our BES annotation, these BACs could be control. When cytogenetic signals of BACs from the same categorized as having (a) EST sequences at both ends; (b) contigmatchedatasinglechromosomalsite,thiswastakenas TEsatbothends;(c)nosignificantsimilaritytoESTsorTEs supportingtheintegrityofthecontig.Thiswasseenforclones at either end; (d) ESTs at one end and no similarity at the 072O21 and 115G22 from contig 2 and clones 008A03 and oppositeend;(e)TEsatoneendandnosimilarityattheother 112E21 from contig 9. Conversely, the BAC-FISH localiza- end; and (f) TEs at one end and ESTs at the other end. We tionofclonesofasinglecontigtodifferentchromosomeswas testedallclonesofcontigs1,3,4,6,7,and10–13andselected takenasnegatingthephysicallinkageoftheseclones,aswas clones of the remaining contigs (one in contig 14, two in demonstrated for clones 015P08, 017B07, 043C18, and contigs 2 and 8, and three in contig 9). We did not test any 115C21fromcontig1.Moreover,threeclonesfromcontig1 BAC from contig 5 because these clones had been compre- previously hybridized to three different chromosomes hensivelyanalyzedinapriorstudyaimedatassigningthefirst (Kaczmarek et al. 2009), further supporting our contention genetic linkage groups (LGs) to chromosomal maps of that we observed false-positive overlapping of these clones. L.angustifolius(Lesniewskaetal.2011).Inthepresentwork, Thus,contig1doesnotcorrectlyrepresentthephysicalstruc- 11 clones produced distinct single-locus signals: one clone ture of a genomic region. Such a false-positive overlapping fromcontig14,twofromcontigs2and9,fourfromcontig1, wasobservedonlyforcontig1. andtwosingletonBACs.Whenwecombinedourresultswith those previously obtained for contig 5 (four clones with GeneticMapping single-locus signals and three with repetitive dispersed sig- nals) (Lesniewska etal. 2011),we found thatapproximately To assign chromosomes to their corresponding linkage 17%oftheSSRprobe-selectedBACsproducedsingle-locus groups,clonesshowingsingle-locusBAC-FISHsignalswere signalsinBAC-FISH.ThehighestpercentagesofBAC-FISH usedformolecularmarkerdevelopmentandgeneticmapping. single-locus clones were observed in sets “f” (26 %), “c” Genetic markers were also generated for clones containing (25%),and“a”(21%).FourclonescontainedrRNArepeats annotated hypothetical genes, with the goal of physically (18SrRNA)atoneoftheirends;theseclonesproducedsingle- localizing the GRRs in the L. angustifolius genome. locus BAC-FISH signals regardless the type of sequence at Seventy-sixBESsfrom44BACswereusedastemplatesfor theoppositeend.Thus,weconcludethatthepresenceofaTE primerdesign(onepairperBES),andtheprimerswereused orESTsequenceatoneendofaBACdoesnotimplythatthe toamplifyDNAisolatedfromtheparentallinesofthemap- clone will yield a repetitive or single-locus signal in BAC- ping population: 83A:476 and P27255. PCR products with FISH. However, all clones that contained TEs at both ends expected lengths and sequences were obtained for all 72 produced repetitive and dispersed signals in our cytoge- primer sets. When no polymorphism between parental lines netic analysis. Thus, when selecting clones for BAC- was found at either end of a BAC clone, the BESs were FISH, BES annotation might be used as an auxiliary step elongatedbySangersequencing,andsubsequentPCRprimer to help sift out clones that are likely to yield repetitive sets were prepared. Fourteen BESs underwent one round of hybridization signals. Of the five clones sequenced, one extension, six underwent two rounds, and one underwent (017B07) hybridized to a single locus in BAC-FISH, three rounds. Sequence polymorphisms between parental whereas the other four showed repetitive signals. Func- lines were identified in 43 PCR products. All marker and tional annotation revealed that clones presenting multiple primersequencesweredepositedinthesequence-taggedsite dispersed signals in BAC-FISH carried numerous inter- databasesoftheNCBI(accessionsGF110936toGF110969) spersed repeats that constituted more than 20 % of their andDDBJ(accessionsAB811081toAB811182,AB811255 insert sequences (Table 4). These results are in line with toAB811351,andAB811459toAB811463). previous findings (Belarmino et al. 2012; Książkiewicz Intotal,35markersoriginatingfrom33BESsof28clones et al. 2013), illustrating that there is a distinct relation- were obtained for use with various detection methods. For ship between the sequence composition of clones (i.e., nine of the markers, primers anchored in polymorphic loci PlantMolBiolRep(2015)33:84–101 93 Table6 Cytogeneticmarkersoflupinchromosomes:co-localizationofclonepairstestedinBAC-FISH 138N02 015P08 017B07 043C18 115C21 072O21a 115G22 008A03 112E01 123A20 083C06 ctg0 ctg1 ctg1 ctg1 ctg1 ctg2 ctg2 ctg9 ctg9 ctg14 N – – – – – – – – – – 044J16 NLL-06 – – – Y – – – – N – 138N02 NLL-14 N N N – – – – – – 015P08 NLL-09 N N N N N N – Y 017B07 NLL-20 – – – – – – – 043C18 NLL-01 N N N N – – 115C21 NLL-14 Y Y Y – – 072O21 NLL-16 Y Y – – 115G22 NLL-16 Y – – 008A03 NLL-16 – – 112E01 NLL-16 – 123A20 - ctgcontiglocalization,NLLlinkagegroupassignment,Yclonesco-localizedtothesamechromosome,Ncloneslocalizedtodifferentchromosomes aBAC072O21wascytogeneticallymappedtotheL.angustifoliuschromosomesbyK.Lesniewska(unpublished) were designed, and allele-specific PCR (AS-PCR) with a other BAC from this contig (Lesniewska et al. 2011). In dominant ratio of segregation was performed. Seventeen contrast, false-positive overlapping of the clones in contig 1 markers were visualized using the CAPS (Konieczny and wasdemonstratedbythelocalizationofgeneticmarkersorig- Ausubel1993)approach,aswewereabletomatchthediffer- inatingfromfourBACsindifferentlinkagegroups. ing nucleotides with the restriction sites of commercially The results of genetic mapping came together with the availableenzymes.Theremainingninemarkerswereresolved resultsofBAC-FISHapproachpresentedinthispaperaswell by the dCAPS method, based on the use of mismatch PCR asbyotherauthors(Kaczmareketal.2009;Lesniewskaetal. primers to introduce a restriction site into the polymorphic 2011). In the first report aimed at karyotyping the narrow- locus.Ourscoringofsegregationdatafromthenarrow-leafed leafedlupin,clonesfromcontigs3(015L10)and6(016J01) lupin mapping population and subsequent linkage analysis localized to the same chromosome, whereas a clone from allowed us to saturate the L. angustifolius genetic map contig 10 (042B18) was placed on another chromosome (Nelson et al. 2010) with 35 new markers distributed to 14 (Kaczmarek et al. 2009). Furthermore, the results of a prior linkagegroups(OnlineResource6).Detailedmarkerdataand cytogeneticassignmentofnarrow-leafedlupingeneticlinkage segregationscoresaregiveninOnlineResource7. groupstochromosomesindicatedthatfourBACclonesfrom Genetic mapping of markers anchored in BAC-end se- contig5werefoundinclosephysicalproximity(Lesniewska quencesallowedustodeterminethegeneticpositionsofthe etal.2011).Thus,thepreviousfindingsareentirelyconsistent vast majority of the non-repetitive genes identified in the with the physical and genetic mapping results described BESs and BACs. Furthermore, the developed markers pre- herein. cisely determined the linkage positions of all but one of the contigs and proved useful for verifying the overlap of the RatioofPhysicaltoGeneticDistances BAC clones. BES-based genetic markers were designed for bothendsofselectedBACs,includingthesingletons,131C21 Theratioofphysicaltogeneticdistanceswascalculatedusing and 060B20, and clones from contigs 3 (clone 015L10), 9 genetic linkage distances and consensus band size data. The (clone 051C12), and 12 (clone 080K03). Such physically distances calculatedfor singletonswereasfollows:131C21, linkedmarkers wereco-localizedonthe narrow-leafed lupin 35 kb/cM; 051C12, 109 kb/cM; and 080K03, 95 kb/cM. geneticmapatdistancesrangingfrom0.6to5.9cM,converg- Those for contigs were as follows: for contig 3, 11 kb/cM; ing with the accuracy of genetic mapping. Four markers contig 5, 150 kb/cM; contig 8, 210 kb/cM; and contig 12, originating from contig 3 (015L10_5D, 111L22_5, 167 kb/cM. The physical-to-genetic distance ratio supports 141C03_5D,and015L10_3)wereclusteredinlinkagegroup thefunctionalannotationprocedure,sincetherecombination NLL-17,spanningarangeof6cM.Twomarkersfromcontig frequency is positively correlated with gene density (Chen 8 (136B16_5 and 112N18_3D) were localized in linkage et al. 2002; Shah and Hassan 2005; Xu et al. 2008). The group NLL-14 at a distance of 0.5 cM. Marker 084P14_5, averagephysicaldistancepercentimorgancalculatedfor245 taggingaclonefromcontig5,wasmapped1.7cMawayfrom synteniclociofP.vulgarisandG.maxwas290kb;however, marker 142D13_3, which was previously developed for the 42 % of the comparisons were <100 kb/cM (McClean et al.