loading

Logout succeed

Logout succeed. See you again!

ebook img

Proposal of new specific status for tea-infesting populations of the nominal citrus spiny whitefly Aleurocanthus spiniferus (Homoptera: Aleyrodidae) PDF

release year2011
file size9 MB
languageEnglish

Preview Proposal of new specific status for tea-infesting populations of the nominal citrus spiny whitefly Aleurocanthus spiniferus (Homoptera: Aleyrodidae)

Zootaxa 2797: 25–44 (2011) ISSN 1175-5326 (print edition) www.mapress.com/zootaxa/ Article ZOOTAXA Copyright © 2011 · Magnolia Press ISSN1175-5334(online edition) Proposal of new specific status for tea-infesting populations of the nominal citrus spiny whitefly Aleurocanthus spiniferus (Homoptera: Aleyrodidae) KENKICHI KANMIYA1, SHIGENORI UEDA2, ATSUSHI KASAI3, KOJI YAMASHITA4, YASUSHI SATO5 & YUTAKA YOSHIYASU6 1Institute of Comparative Studies of International Cultures and Societies, Kurume University, Mii-machi 1635, Kurume, Fukuoka 839- 0851, Japan. E-mail k_kanmiya @nifty.com 2National Agricultural Research Center for Kyushu Okinawa Region, Mii-machi 1823-1, Kurume, Fukuoka 839-8503, Japan. E-mail [email protected] 3Laboratory of Applied Entomology, Graduate School of Life and Environmental Sciences, Kyoto Prefectural University, Shimogamo, Kyoto 606-8522, Japan. E-mail [email protected] 4Tea Industry Research Division, Agriculture and Forestry Technology Department, Kyoto Prefectural Agriculture, Forestry and Fish- eries Technology Center, Nakanosono, Shirakawa, Uji, Kyoto 611-0022, Japan. E-mail k-yamashita13 @pref.kyoto.lg.jp 5National Institute of Vegetable and Tea Science, National Agriculture and Food Research Organization, Kanaya, Shimada, Shizuoka 428-8501, Japan. E-mail [email protected] 6Laboratory of Applied Entomology, Graduate School of Life and Environmental Sciences, Kyoto Prefectural University, Shimogamo, Kyoto 606-8522, Japan. E-mail [email protected] Abstract The citrus spiny whitefly Aleurocanthus spiniferus (Quaintance) is a pest of citrus plants that is native to South-East Asia. Although serious outbreaks of the tea-infesting whitefly in China, Taiwan and Japan have been attributed to this species over the last 20 years, recent research has shown different host preferences between the two whiteflies. Hence, the two pests have tentatively been differentiated as tea-infesting and citrus-infesting populations. We further compared morpho- logical, acoustic and genomic features between the two populations in Japan. Morphological differences were recognised in the arrangement of spines, porettes and papillae on the dorsal disc and number of marginal crenulations and marginal waxy fringe of 4th-instar nymphs, as well as wing maculation and genitalic organs of adults. In courtship behaviour, the acoustic properties of male vibratory signals also differed between the two. Furthermore, genetic analysis of mtCOI se- quences (759 bp) showed that the tea-infesting population was clearly distinct from the citrus-infesting group, with high bootstrap values. The mtCOI sequence identities were 76.2% between the two populations. Genetic differentiation be- tween the two populations was shown by the high value (0.99650) of pairwise Fst, indicating the sexual isolation of the two populations. Consequently, these two populations are regarded as different representatives, consisting of a sibling re- lationship, but clearly distinguished from each other as independent genomic populations. Here, we describe the tea-in- festing population and propose a new scientific name, Aleurocanthus camelliae Kanmiya & Kasai sp. nov., and a new common name, camellia spiny whitefly, thus distinguishing it from A. spiniferus (Quaintance), the citrus spiny whitefly that constitutes the citrus-infesting population. Key words: Aleyrodidae, citrus spiny whitefly, host preference, mating signals, mtCOI sequences, new species, tea pest Introduction The citrus (or orange) spiny whitefly Aleurocanthus spiniferus (Quaintance) is among the most serious pests of cit- rus plants (Byrne et al. 1990). It originated in tropical Asia and has spread to Africa, Australia, the Pacific Islands and Italy (Nguyen et al. 1993; Gyeltshen et al. 2010). A. spiniferus was recognised to be an invasive pest of citrus plants planted in Nagasaki, Japan, in 1915; thereafter, it spread rapidly to Kyushu, becoming an exceedingly destructive pest (Clausen 1978). However, A. spiniferus was fully controlled on citrus by an introduced parasitoid wasp (Encarsia smithi) from China, and heavy infestations decreased to a low level (Kuwana & Ishii 1927; Ohgushi 1969). In addition to being a citrus pest, A. spiniferus has also been thought to damage tea plants (Camel- Accepted by J. Martin: 8 Feb. 2011; published: 22 Mar. 2011 25 lia sinensis) in temperate China over the past 20 years. Han and Cui (2003) reviewed several prominent outbreaks said to involve A. spiniferus in the main tea regions of China since the 1960s. The distributional range of A. spiniferus appeared to have fully expanded to the tea-growing regions of China by 1989. The presence of A. spiniferus in tea gardens eventually spread to Taiwan (Suh 1994) and Japan (Yamash- ita et al. 2005), although no records of A. spiniferus occurring as a pest of Ca. sinensis,Camellia sasanqua or Cley- era japonica and Eurya japonica existed at that time in Japan (Japanese Society of Applied Entomology and Zoology 2006). The tea-infesting A. spiniferus population in Japan quickly spread to four prefectures in Kinki dis- trict by 2008, and subsequent outbreaks followed in another eight prefectures during 2009–2010 (Kasai et al. 2010). Kasai et al. (2010) investigated the host plant suitability of some Camellia and Citrus plant species for tea- and citrus-infesting A. spiniferus populations in Japan. They recognised significant differences in host preference between two populations based on oviposition and larval feeding behaviour. The citrus-infesting population laid no eggs on Camellia leaves, whereas the tea-infesting population laid a few eggs on Citrus but no nymphs settled on Citrus leaves. Kasai et al. (2010) suggested that the Japanese tea-infesting population was derived from that of China or Taiwan. In this study, we extensively compared all adult and nymphal stages of the tea-infesting popula- tion, reared from five theaceous plants, and the citrus-infesting population, reared from three rutaceous plants, to ascertain morphological differences between the two. In a preliminary investigation of male mating signals of both populations using tea-infesting whiteflies obtained from Uji, Kyoto, and citrus-infesting whiteflies from Okabe, Shizuoka, Japan, we recognised differences in acoustic properties between the host types (Kanmiya et al. 2009). In this study, we added acoustic data from specimens obtained from tea plants in four different prefectures and citrus plants from Shizuoka Prefecture, distin- guishing them as the tea- and citrus-infesting populations. Material and methods Taxonomy. For microscopic examination, nymphs and puparia were mounted using the following method: Live nymphal materials were treated with 10% KOH solution for 1–2 nights at room temperature or heated gently below the boiling point for about 5 min; removed from the KOH solution and placed in 70% acetic acid for 30 min at room temperature; placed in 2.5–3.5% hydrogen peroxide to bleach the black cuticle to a brownish colour; rinsed with 85% ethanol; placed in lactophenol and heated at 70°C for 30 min; removed from lactophenol and placed in 70% acetic acid for 30 min at room temperature; placed in glacial acetic acid for 30 min; removed from glacial ace- tic acid, treated with acetosalicylate and heated at 70°C for 30 min; transferred to carboxylol for 20 min at room temperature and finally mounted in Canada balsam. The morphological terminology for nymphs and adults was that of Bink-Moenen (1983), Martin (1985) and Gill (1990). Morphological observation. A digital HF microscope ( VH-8000 or VHX-1000, KEYENCE, Tokyo, Japan) with a zoom lens (VH-Z450 or VH-Z75, KEYENCE) and a scanning electron microscope (VE-9800, KEYENCE) were used at the Institute of Comparative Studies of International Cultures and Societies, Kurume University, Kurume, Japan. A scanning electron microscope (JSM-5510LV; JEOL, Tokyo, Japan) and optical stereomicro- scope (DM2500; Leica, Wetzlar, Germany) were also used at the Graduate School of Life and Environmental Sci- ences, Kyoto Prefectural University, Kyoto, Japan. Body parts were measured using a calibrated ocular micrometer. Morphometric analysis. To compare the quantitative characters of the two pest populations, we collected 4th- instar nymphs of tea- and citrus-infesting populations. Table 1 lists the specimens used in this study. In 2010, 45 female 4th-instar nymphs of a tea-infesting population were collected in Kyoto City and Yame district, Japan, and 53 female 4th-instar nymphs of a citrus-infesting population were collected in Shizuoka City, Shimizu City and Seiyo City, Japan. The live individuals were measured (width of fringe wax) under a stereomicroscope. In 2009, 39 female 4th-instar nymphs of a tea-infesting population were collected in Uji City, Ohchi district and Yame district, Japan, and 40 female 4th-instar nymphs of a citrus-infesting population were collected in Kyoto City, Chikugo City and Karatsu City, Japan. These individuals (after preservation in 99% ethanol) were measured (number of marginal crenulations, body length and body width) under a stereomicroscope. The width of fringe wax and the number of marginal crenulations were analysed at the p= 0.05 level of significance using Holm's sequentially rejective Bon- ferroni tests after Wilcoxon’s rank-sum tests (Holm 1979). The body length and body width data were pooled for each species and analysed at the p= 0.05 level of significance using Wilcoxon’s rank-sum test. 26 · Zootaxa 2797 © 2011 Magnolia Press KANMIYA ET AL. Acoustic analysis. We compared acoustic properties of male mating signals in tea- and citrus-infesting popula- tions. The adult males used in this study originated from the following: Sayama, Saitama Prefecture (recorded Oct. 2009, 3 individuals), Uji, Kyoto Prefecture (Aug. 2008, 3 individuals), Ohchi, Shimane Prefecture (July 2009, 3 individuals), Yame, Fukuoka Prefecture (Sept. 2009, 4 individuals) reared on tea plants, plus Okabe, Fujieda, Shi- zuoka Prefecture (May 2008, 8 individuals) reared on the citrus plant Citrus unshiu. Host plants infested with nymphs were collected from the tea or citrus fields and reared in the laboratory at Kurume University (light:dark, 14:8 h; 25 ± 2°C room temperature) to adult emergence. The emerged adults used for mating in acoustic experi- ments were separated by sex in the early morning (08:00–09:30) each day, and all males were discarded in the late evening. Virgin male and female adults more than 6 h old were paired and released into a small cylindrical plastic case that contained a piece of live host leaflet. Acoustic recordings were conducted in an anechoic room or an anechoic chamber at 25 ± 2°C. The signal recording and analysing systems were as shown in Kanmiya (1996). The apparatus used to detect substrate transmitted signals in courtship was illustrated in Kanmiya (2006). Molecular phylogenetic and population genetic analyses. Aleurocanthus populations for mitochondrial cytochrome oxidase I (mtCOI) gene sequence analysis were collected from 10 regions (7 prefectures) in Japan (Table 2). DNA extraction was performed as described in Ueda and Brown (2006). Whiteflies were ground in extraction buffer (50 mM Tris-HCl, pH 7.0; 100 mM NaCl; 10 mM EDTA; 1% SDS) and treated with a TE-satu- rated phenol:chloroform:isoamyl alcohol (25:24:1) solution. After centrifugation, the supernatant was mixed with 0.1 volume of 3 M sodium acetate (pH 5.2) and 3 volumes of ethanol. Nucleic acids were precipitated by centrifu- gation (14,000 RPM, 10 min) at 4°C and dissolved in distilled water. The mtCOI gene sequence was amplified by polymerase chain reaction (PCR) using Ex Taq polymerase (Takara, Shiga, Japan) with the primers 5'- TTGATTTTTTGGTCATCCAGAAGT -3' and 5'- TCCAATGCACTAATCTGCCATATTA -3' (Frohlich et al. 1999). The PCR products were cloned into a pGEM-T Easy Vector (Promega, Madison, WI, USA). DNA sequences for deposit in the DDBJ/EMBL/GenBank databases were determined for cloned inserts from independent plasmids using a BigDye Terminator Cycle Sequencing Kit v3.1 (Applied Biosystems, Foster City, CA, USA) and resolved using an ABI PRISM 3100-Avant Genetic Analyser (Applied Biosystems). Phylogenetic relationships were analy- sed using 759-bp mtCOI sequences from Aleurocanthus populations, including Aleurotrachelus camelliae Kuwana as an outgroup (Table 2). Its relatedness to genus Aleurocanthus is highlighted by features held in common, includ- ing similar wing maculation and pulsed mating signals in adult males, black puparium metallic and broadly elliptic, pointed frontal and rounded hind end, adhesive secretion and distinctly sclerotised outer margin and operculum broadly occupying the vasiform orifice. Phylogenetic relationships were determined using the maximum-likeli- hood (ML) method of PhyML 3.0 (Guindon & Gascuel 2003). Bootstrap values were calculated using the Hase- gawa–Kishino–Yano (HKY) model of nucleotide substitution, with 1000 replicates. Genetic distances between mtCOI sequences of Aleurocanthus populations were estimated using Kimura's two-parameter model in MEGA 4.0 (Tamura et al. 2007). DnaSP v.5.10 (Librado & Rozas 2009) was used to evaluate the number of haplotypes, haplotype diversity values, nucleotide diversity and the average number of differences within populations, along with pairwise estimates of Fst between populations. Taxonomy GenusAleurocanthus Quaintance & Baker, 1914 Aleurocanthus Quaintance & Baker, 1914: 102. Type species: Aleurodes spinifera Quaintance, 1903: 63–64, by original desig- nation. Aleurocanthus Quaintance and Baker:Quaintance and Baker, 1917 (15 spp. worldwide). —Corbett, 1935 (8 spp. from Malay- sia). —Takahashi, 1942 (8 spp. from Thailand). —Takahashi, 1956 (3 spp. from Micronesia). —David and Subramaniam, 1976 (14 spp. from India). —Dubey and Sundararaj, 2005 (31 spp. from India). —Martin, 1987 (5 spp. of worldwide pests). —Martin, 1999, 2005 (generic diagnosis). Generic diagnosis. The genus Aleurocanthus Quaintance & Baker is readily recognised in puparium by many stout glandular spines on the dorsal disc and submargin, and the usual carriage of exuviae of earlier instars in a stack on the dorsum, as well as white marginal waxy fringes. Martin (1987) prepared a key to a few species of this NEW STATUS FOR CITRUS SPINY WHITEFLY Zootaxa 2797 © 2011 Magnolia Press · 27 genus which infest economically important plants. The key included detailed figures of five species, including A. spiniferus. Puparium medium in size, subelliptical or oblong in outline, colour usually dark brown to black and often fringed with white waxy secretion marginally. Margin distinctly crenulate or truncate-lobulate; submarginal area not separated from dorsum by suture. Thoracic and caudal tracheal folds and combs not discernible from dorsal view; dorsal disc and/or submargin covered with stout glandular spines of various length with acute or fimbriate apices; cephalic, 8th abdominal and caudal setae present; caudal furrow absent. Vasiform orifice small, subcircular or subcordate in outline, highly elevated as a tubercle-like projection of dorsum; operculum elliptical, almost filling orifice; lingula visible or concealed. Adult forewing usually dusky having several paler maculae, with radius and cubitus, and a prominent flexure present at the branch of R1 (vestigial) and Rs suddenly curving posteriorly at the branch beyond mid-wing length; hind wing with only radius, prominent maculation absent. Remarks. The genus currently contains around 80 described species worldwide (Martin & Mound 2007; Evans 2008). It is well represented in the Oriental region, with about 50 described species. In Japan, only two spe- cies, A. cinnamomi Takahashi, 1931 and A. spiniferus (Q., 1903) are currently distributed (Miyatake 1980). The outbreak population currently infesting tea plants and that on citrus plants, which has been long established, have hitherto both been called A. spiniferus in Japan, China and Taiwan. The first observation that the host plant prefer- ence of Japanese tea-infesting population differs from that of the citrus-infesting population of A. spiniferus (Kasai et al. 2010) led to this investigation of possible differences in species recognition between them based on morpho- metric, bioacoustic and genome analyses, as discussed below. TABLE 1. Geographic origin, collection date and host plants of sample populations used for morphometric analysis. Species Acronym Geographic origin (prefecture) Host Plant Date n A. camelliae Uji† Uji (Kyoto) Ca. sinensis 24 July 2009 21 Kyoto* Kyoto (Kyoto) Ca. sasanqua 4 Apr. 2010 22 Ohchi† Ohchi (Shimane) Ca. sinensis 15 July 2009 6 Yame† Yame (Fukuoka) Ca. sinensis 23 Sept. 2009 12 Yame* Yame (Fukuoka) Ca. sinensis 18 Dec. 2009 23 A. spiniferus Shizuoka* Shizuoka (Shizuoka) Ci. unshiu 22 Feb. 2010 12 Shimizu* Shizuoka (Shizuoka) Ci. unshiu 16 Apr. 2010 24 Kyoto† Kyoto (Kyoto) Ci. unshiu 25 Apr. 2009 12 Seiyo* Seiyo (Ehime) Ci. unshiu 29 Apr. 2010 17 Chikugo† Chikugo (Fukuoka) Ci. natsudaidai 23 Nov. 2009 10 Karatsu† Karatsu (Saga) Ci. unshiu 20 July 2009 18 *Width of fringe wax measured from live samples. †Number of marginal crenulations, body length and body width measured from samples in ethanol. Description of species Aleurocanthus camelliae Kanmiya & Kasai, sp. nov. Puparium. (Figs. 1F, H, I, 3E, 6A) Length: (female) 1084.8 ± 51.1 μm (mean ± SD), range: 988–1237 μm (n = 42); (male) 796.3 ± 23.2 μm, range: 650–858 (n = 41); width: (female) 751.5 ± 45.9 μm, range: 624–858 μm; (male) 491.3 ± 29.5 μm, range: 390–572 μm. Dorsum highly sclerotised, oval-shaped, convex on submedian areas of cephalothorax and abdomen; middle length of puparium located at abdominal segments II (75%) or III (25%) in the female and abdominal segments I (71%) or II (29%) in the male. Length/width ratio of puparium: (female) 1.45 ± 0.1 μm (n = 18); (male) 1.62 ± 0.1 μm (n = 24). Cephalic eyespot ovoid, clearly defined with a distinct rim, located laterally and close to base of 3rd submarginal spine. Dorsal abdominal sutures distinct on segments III/VIII, especially depressed as a deep suture on VII/VIII. Tergite VIII 49.0 ± 6.9 μm long and 0.74 ± 0.11 times as long as the width of the vasiform orifice (female, n = 10). Vasiform orifice distinctly elevated, obtuse, 1.28 ± 0.08 times 28 · Zootaxa 2797 © 2011 Magnolia Press KANMIYA ET AL. longer than wide, 84.3 ± 4.1 μm long, 65.9 ± 2.3 μm wide (female, n = 10), inset from posterior puparial margin by its own width, fully occupied by the operculum, which obscures lingula unless operculum is raised. Operculum in dorsal view 58.9 ± 8.9 μm long, 56.1 ± 6.4 μm wide (female, n = 10), with posterior margin roundly depressed and fringed by thick, microscopic hairs. Lingula usually not visible in the final pupal stage, but always prominent in 4th nymphal stage, seemingly bi-segmented, with dense microscopic hairs and a pair of long setae apically (Fig. 4B); its length subequal to length of operculum when protruding to excrete. Margin. Outline oblong, widest across abdominal segment II/III in the female, and across abdominal segments I/II in the male; marginal crenulation rather tightly arranged with 1.1–1.3-μm gap between the teeth (Fig. 5E): each tooth 20–22 μm long, 12.5–14 μm wide, total number of marginal crenulations 174.6 ± 10 (n = 21) in female; num- ber of teeth within 0.1 mm: 6–8 in female, 7–10 in male. Microscopic submarginal papillae present roughly in a μ row outside of submarginal spines that are approximately 2 m long, 3–5 in number between spines (Figs. 1H, 4D). TABLE 2.Geographic origin, collection years and host plants of sample populations used for molecular phylogenetic and pop- ulation genetic analysis. Code Acronym Geographic origin Year Host plant Species Accession no. No. (prefecture) 1 Toshima Toshima (Kumamoto) 2008 Ci. natsudaidai A. spiniferus AB536792 2 Ashikita Ashikita (Kumamoto) 2008 Ci. unshiu A. spiniferus AB536793 3 Chikugo Chikugo (Fukuoka) 2009 Ci. natsudaidai A. spiniferus AB558172 4 Uji Uji (Kyoto) 2008 Ca. sinensis A. camelliae AB536794 5 Kameyama Kameyama (Mie) 2009 Ca. sinensis A. camelliae AB536795 6 Yagyuu Yagyuu (Nara) 2009 Ca. sinensis A. camelliae AB536796 7 Shigaraki Shigaraki (Shiga) 2009 Ca. sinensis A. camelliae AB536797 8 Asamiya Asamiya (Shiga) 2009 Ca. sinensis A. camelliae AB536798 9 Toyonaka Toyonaka (Osaka) 2009 Ca. sinensis A. camelliae AB536799 10 Daito Daito (Osaka) 2009 Ca. japonica A. camelliae AB536800 11 Tsubaki Kurinodake (Kagoshima) 2009 Ca. japonica Aleurotrachelus AB536801 camelliae TABLE 3. Nymphal chaetotaxy of A. camelliaesp. nov. Nymphal chaetotaxy 1st instar 2nd instar 3rd instar 4th instar Anterior marginal setae 4 0 0 0 Cephalic setae 0 1 1 1 Cephalo-thoratic spines 2 6 7 9 Abdominal spines Submedian 0 0 1 3 Subdorsal 0 4 6 7 Submarginal spines Cephalothorax 0 0 0 5 Abdominal 0 0 0 6 (5) 8th abdominal setae 1 1 1 1 Caudal setae 1 1 1 1 Posterior marginal setae 1 0 0 0 Total setae 7 3 3 3 Total spines 2 10 14 30 (29) In total 9 13 17 33 (32) Numbers in parentheses indicate the number of males. NEW STATUS FOR CITRUS SPINY WHITEFLY Zootaxa 2797 © 2011 Magnolia Press · 29 FIGURE 1. (A–F): Photomicrographs of slide-mounted Aleurocanthus camelliaesp. nov. (A) 1st-instar nymph, dorsal view; (B) 1st-instar nymph, lateral view; (C) 2nd-instar nymph, dorsal; (D) 2nd-instar nymph, lateral; (E) 3rd-instar nymph, dorsal; (F) 4th-instar nymph, dorsal; (G) A. spiniferus, puparial submarginal area, dorsal; (H, I) A. camelliae, puparium; (H) submarginal area; (I) abdominal tergites III–VII, showing spines and paired pores; (J) A. spiniferus, showing subdorsal spines, single pores, submarginal spines and porettes. Scale bars show 100 μm. Chaetotaxy. Dorsal surface with 11 (female) or 10 (male) submarginal glandular spines (Figs. 1F, 3E, Table 3) that are about 90–110 μm long. Cephalic setae and 8th abdominal seta subequal in length, about 82 μm; caudal seta much longer, about 134 μm; abdominal submedian spines 3 pairs, located on abdominal tergites I/III, of which the anteriormost is shortest, about 30 μm long, middle is longest, about 130 μm; abdominal subdorsal spines 7 pairs, of which the stout 4th spine is longest and the loci among bases of the 2nd to 5th setae placed roughly linearly. Paired, very closely placed, black microscopic pores present near outside of submedian abdominal spines in vivid pupar- ium (Fig.1I). Venter. (Fig. 4A ): Surface rather smooth; wool-fibre-like, waxy bundle flowing between 1st and 2nd legs, indi- cating tracheal fold, but no pore and comb observed in the tip; caudal fold absent; antennae often retreated behind foreleg. Rostrum seemingly 3-segmented, 128 μm long in all, basal 1/3 thickened, with 42-μm basal width, distally 30 · Zootaxa 2797 © 2011 Magnolia Press KANMIYA ET AL. μ narrowed, with a needlelike stylet bundle nearly 56 μm long. Pair of fine ventral abdominal setae 20–23 m long; spinules scattered around the area of setae. Row of waxy projections produced along inner side of marginal teeth, which line up at slightly wider intervals than marginal teeth, comprising approximately 70% of total marginal teeth; each projection 20–30 μm long, mushroom-like, with basal stalk and flat top, which may serve as larval adhesive to leaf surface. FIGURE 2. Habitus photographs. (A–H, K, L) A. camelliaesp. nov. (A) ovum, lateral view; (B) 1st-instar nymph; (C) 2nd-instar nymph; (D) 3rd-instar nymph; (E) 4th-instar nymph; (F) adult emerging; (G) puparium (Osaka, Daito City, reared from Ca. japonica); (H) puparium (Kyoto, Uji City, reared from Ca. sinensis); (I, J) A. spiniferus; (I) puparium (Fukuoka, Kurume City, reared from Ci. natsudaidai); (J) puparium (Shizuoka, Shimada City, reared from Ci. unshiu); (K) female forewing; (L) female, hind wing (both Shimane, Ohchi-gun, reared from Ca. sinensis). Scale bars show 100 μm. Adult (female). Body length 1.25–1.40 mm. Head in dorsal view 244–272 μm wide, 2.25–2.3 times wider than frons; frons 100–110 μm long, 105–132 μm wide, weakly protruded from eye margin; eye 74–84 μm wide in dorsal view, upper and lower compound eyes connected by 3 ommatidia (Fig. 5A). Antennae (Fig. 6B) 260–320 μm in total length, two basal segments greyish-brown, distal 5 segments yellowish-white, two basal segments thickened, the 2nd nearly 3 times longer than the 1st, the 3rd segment longest, 86.2 ± 4.9 μm long (n = 6), with subapi- cal sensoria and a cone at distal 3/5 of its length, the 7th segment also with a sensorial cone deriving at mid-length. NEW STATUS FOR CITRUS SPINY WHITEFLY Zootaxa 2797 © 2011 Magnolia Press · 31 Rostrum 136–155 μm total length, seemingly 3-segmented, basal segments 92 μm long, 44 μm wide, distal seg- ments 66 μm long, 24 μm wide, apically browned. Forewing (Figs. 2K, 3A, D): 1.1–1.2 mm long, 413–550 μm (cid:0)(cid:2)(cid:3) (cid:0)(cid:2)(cid:3) wide at widest width (across Fig. 3A, ) and 320–450 μm wide at middle of wing (across Fig. 3A, ), with 9 greyish-white maculae (Figs. 2K, 3A), their maculation most distinct soon after emergence (Fig. 3D), then turning largely brownish-green or brownish-blue, with maculae somewhat obscured by waxy powders. Hind wing (Figs. 2L, 3A) 0.95–1.02 mm long, 0.41–0.4 mm wide, evenly greyish-white, or with several blurred maculae depending on age. Abdomen with two ventral wax plates. Adult (male). Body length 0.90–1.10 mm. Wing maculation almost identical to that of female. In dorsal view, tergal sclerite I vestigial, II invisible, III/VIII and subgenital plate distinct (Fig. 6E), highly darkened on tergites VI/ VII, subgenital plate and claspers; each III/V tergite subequal in length, about 44 μm; tergite VI longest, 64 μm long; tergite VII reduced, 15 μm long, laterally extended and enclosing 7th spiracle; tergite VIII a small square, dis- tally leaning on subgenital plate. Forewing 0.84–0.9 mm long, about 0.37 mm wide. Vasiform orifice in dorsal view about 45–59 μm long, nearly 1.2–1.3 times longer than wide; operculum rounded with distal incision, 23–35 μm long and wide; lingual 23–28 μm long, 8–11 μm wide. In lateral view, subgenital plate about 85–100 μm deep and 77–85 μm long, widely concave on anterior margin and gently depressed on ventral margin. Four distinct ven- tral abdominal wax plates (Fig. 6F). Genitalia. (Figs. 4E, F, 6C) Aedeagus 108–120 μm long, gradually broadened basally to 23–27-μm basal width, upcurved toward apex and with slender distal half, apex extending near distal 3/4 length of clasper; clasper in dorsal view 108–123 μm long, weakly incurved and narrowed distally, angulate on outer subbasal corners, with a thin inflatable sac and apical spine. Ovum. (Fig. 2A) Elliptical, the lower surface convex and the upper surface slightly concave, similar to a short banana shape; 219.7 ± 13.2 μm long (n = 11), 95.2 ± 16.5 μm wide (n = 11); stalk 49.4 ± 3.9 μm long (n = 9). First-instar nymph. (Figs. 1A, B, 2B) (male and female): Elongate-oval, normally widest at posterior 3/5 length; 297 ± 18.9 μm long (n = 15), 132.8 ± 17.3 μm wide (n = 10), 93.9 ± 9.9 μm high (n = 9); ratio of length/ width 2.12 ± 0.12 (n = 5). Vertex conical, gradually widening posteriorly, suddenly recessed near laterobasal mar- gins of vasiform orifice; prominent protuberance developed at mesial cephalad region and around vasiform orifice; pair of elongate arcing spines behind cephalic protuberance and posterior thoracic margin, with anterior spine 196 ± 25 μm long (n = 15), posterior spine 114 ± 12 μm long (n = 11). Four pairs of fine anterior marginal setae and one pair of fine posterior marginal setae present. Second-instar nymph. (Figs. 1C, D, 2C) More ovate, normally widest at anterior 1/3 length; 442.8 ± 71.2 μm long (n = 10), 277.2 ± 53.5 μm wide (n = 8), about 141–144 μm high; ratio of length/width 1.62 ± 0.08 (n = 8); 6 pairs of cephalothoracic and 4 pairs of abdominal subdorsal spines well developed, of which mesial 2 thoracic spines longest, 175–223 μm. Third-instar nymph. (Figs. 1E, 2D) Elliptical, normally widest at anterior 1/3 length; 611.3 ± 71.6 μm long (n = 10), 403.5 ± 47.4 μm wide (n = 10), ratio of length/width 1.58 ± 0.08 (n = 10); 7 pairs of cephalothoracic and 7 pairs (1 submedian and 6 subdorsal) of abdominal spines present. Habitus. Puparium. Metallic black, medially and peripherally surrounded by white marginal waxy fringe (Fig. 2G, H), width of which (female) 90–160 μm (11–16% width of puparium), (male) 66–150 μm (6–12% width of puparium). Tips of cephalothoracic and abdominal submarginal spines extending to outer edge of white marginal fringe or slightly protruding beyond it. Exuviae of earlier instars (usually 2nd and 3rd) often remain stacked up on median area of immature insect (Fig. 2E). Adults. After emergence, eye, thorax and abdomen predominantly reddish-yellow (pinkish), except frons, antennae and legs light yellow, then turning orange to light brown to dark brown, covered by wax powder coating except ruby eye. Wing also pale brown ground colour, with clear white original maculae (Fig. 3D), then totally turning purple–brown to greenish-brown and the maculation somewhat obscured by white waxy powder; fore- wings bearing 9 white maculae as in Figures 2K and 3A; hind wing pale brown or greyish, without prominent mac- ulae. Ocellus light brown; rostrum darkened at apex. Body and wing surfaces appear white, owing to wax secretions produced from abdominal waxy plates shortly after emergence by manipulating hind legs against glan- dular pores. Ova and nymphs. Newly deposited eggs pale yellow, then turning brown to darker before hatching; newly emerged nymphs transparent, appearing rather greenish by reflecting colour of leaves, then gradually darkening, finally becoming metallic black; 1st-instar nymph starts producing white waxy fringes marginally (Fig. 2B) soon 32 · Zootaxa 2797 © 2011 Magnolia Press KANMIYA ET AL. after sessile state. Width of marginal waxy fringe: 1st-instar nymph (16 ± 3 μm wide, range 12–21 μm) (n = 13); 2nd- instar nymph 29 ± 4.3 μm wide, range 23–48 μm) (n = 5); 3rd-instar nymph 56 ± 7.2 μm wide, range 4–84 μm (n = 6). FIGURE 3. Habitus photographs. (A, C, E) A. camelliaesp. nov. (B, D, F) A. spiniferus. (A, B) Female right wings (A, Kyoto, Uji City; B, Fukuoka, Chikugo City). (C, D) Adult females, 30 min after emergence (C, Kyoto, Uji City; D, Shizuoka, Shimizu City). (E, F) Female puparia (E, Shiga, Koka City; F, Kumamoto, Toshima City). Scale bars show 500 μm. NEW STATUS FOR CITRUS SPINY WHITEFLY Zootaxa 2797 © 2011 Magnolia Press · 33 FIGURE 4. (A–F): Aleurocanthus camelliae sp. nov. (Kyoto, Uji City, reared from Ca. sinensis). (G, H) A. spiniferus. (A) SEM of 4th-instar nymph; (B) SEM of 4th-instar nymph, vasiform orifice; (C) SEM of 4th-instar nymph, with 2nd–3rd exuvia in dorsal; (D) SEM of 4th-instar nymph, marginal teeth and submarginal spines and porettes. (E–H) SEM of male aedeagus (E, Kyoto, Uji City, reared from Ca. sinensis; F, Kyoto, Kyoto City, reared from Ca. sasanqua; G, Ehime, Seiyo City, H, Shizuoka, Shimizu City, both reared from Ci. unshiu). Host plants. Theaceous genera Camellia, Eurya and Cleyera species: Camellia sinensis, Ca. sasanqua, Ca. japonica,Eurya japonica and Cleyera japonica. Material examined. Holotype puparium (female), Uji, Kyoto Prefecture, on tea, Camellia sinensis, 19.iii.2010, A. Kasai leg., deposited in Insect Museum, National Institutes for Agro-Environmental Science, Tsu- 34 · Zootaxa 2797 © 2011 Magnolia Press KANMIYA ET AL.

See more

The list of books you might like