Logout succeed
Logout succeed. See you again!

Propagation of human germ stem cells in long-term culture. PDF
Preview Propagation of human germ stem cells in long-term culture.
Iran J Reprod Med Vol. 11. No. 7. pp: 551-558, July 2013 Original article Propagation of human germ stem cells in long-term culture Mohammad Mehdi Akhondi1 Ph.D., Arash Mohazzab1 M.D., Mahmood Jeddi-Tehrani2 Ph.D., Mohammad Reza Sadeghi2 Ph.D., Akram Eidi3 Ph.D., Abbas Khodadadi4 Ph.D., Zeinab Piravar3 Ph.D. 1. Reproductive Biotechnology Abstract Research Center, Avicenna Background: Spermatogonial stem cells (SSCs), a subset of undifferentiated type A Research Institute, ACECR, Tehran, Iran. spermatogonia, are the foundation of complex process of spermatogenesis and could 2. Monoclonal Antibody Research be propagated in vitro culture conditions for long time for germ cell transplantation Center, Avicenna Research and fertility preservation. Institute, ACECR, Tehran, Iran. Objective: The aim of this study was in vitro propagation of human spermatogonial 3. Department of Biology, Science and Research Branch, Islamic stem cells (SSCs) and improvement of presence of human Germ Stem Cells Azad University, Tehran, Iran. (hGSCs) were assessed by specific markers POU domain, class 5, transcription 4. Research and Preparation factor 1 (POU5F1), also known as Octamer-binding transcription factor 4 (Oct-4) Center, Iranian Tissue Bank, and PLZF (Promyelocytic leukaemia zinc finger protein). Tehran University of Medical Science, Tehran, Iran. Materials and Methods: Human testicular cells were isolated by enzymatic digestion (Collagenase IV and Trypsin). Germ cells were cultured in Stem-Pro 34 media supplemented by growth factors such as glial cell line-derived neurotrophic factor, basic fibroblast growth factor, epidermal growth factor and leukemia Mohammad Mehdi Akhondi and Arash Mohazzab are equally the inhibitory factor to support self-renewal divisions. Germline stem cell clusters were first author. passaged and expanded every week. Immunofluorecent study was accomplished by Corresponding Author: Anti-Oct4 antibody through the culture. The spermatogonial stem cells genes Zeinab Piravar, Islamic Azad expression, PLZF, was studied in testis tissue and germ stem cells entire the culture. University, Science and Research Branch Faculty of Basic Sciences, Results: hGSCs clusters from a brain dead patient developed in testicular cell Martyr Sattari Highway, culture and then cultured and propagated up to 6 weeks. During the culture Oct4 University Square, Martyrs were a specific marker for identification of hGSCs in testis tissue. Expression of Hisarak Blvd., Tehran, Iran. PLZF was applied on RNA level in germ stem cells. P.O.Box. 775/14515. Zip Code: 1477893855 Conclusion: hGSCs indicated by SSCs specific marker can be cultured and Email: [email protected] propagated for long-term in vitro conditions. Tel/Fax: (+98) 2144845144 Key words: Human germ stem cells, Human Spermatogonial stem cells, SFM, GDNF, LIF, Received: 19 June 2012 OCT-4, PLZF. Revised: 13 December 2012 Accepted: 9 January 2013 This article extracted from Ph.D. Thesis. (Zeinab Piravar) Introduction the cells and regulation of early phases of spermatogenesis by molecular mechanisms S permatogenesis is a complex are considered. However, there are many process originates from restrictions on the research on human Spermatogonial stem cells (SSCs) spermatogonia. that is maintained through adult life of the One reason for such a little advance in male testes. SSCs that are a subset of human spermatogonia and SSCs studies has undifferentiated type A spermatogonia, place been limited amounts of normal human testis in a stem cell niche at the basement for research purposes (6). Another reason has membrane (BM) of the seminiferous tubules been restricted cell divisions and (1). Spermatogenesis begins at 5-7 days post consequently close distance between natal in rodents and 10-13 years after birth in undifferentiated and differentiated men (2). Previous experiments on rodent spermatogonia during spermatogenesis spermatogonia demonstrated efficiently process compare with rodents and other isolation and short or long-time culture of primates (7). Clermont in 1963 characterized these cells (3-5). According to these studies, two types of undifferentiated spermatogonia in factors that control the fate determination of human testis; the A and A dark pale Akhondi et al spermatogonia that are different in their cells and identified these cells by specific chromatin distribution. They informed that the markers, OCT-4 and PLZF. A was reserve stem cells while the A was dark pale renewing stem cells and both of them were Materials and methods placing in stem cell niche at the basement Human germ stem cells culture membrane of seminiferous tubules (1, 7-9). In this experimental study, testis samples However, after more than forty years of were donated from a brain dead 44 years old Clermont’s findings, very little new patient with acquisition consent inform. Ethical progression is available on the identification, aspects of sampling and other procedure of renewing or differentiation of human SSCs study were approved by Avicenna institute (10). ethics committee and National Ethical Specific growth factors were examined in Committee on Research in Medical Sciences. extra cellular matrix or niche of SSCs Spermatogenesis process was normal in stimulate self-renewing and maintenance of testis tissue. The sample was cut into small these cells as glial cell line-derived pieces (25 mm3) and stored by neurotrophic factor (GDNF) that produce by cryopreservation method in 10% dimethyl sertoli cells. According to this observation, a sulfoxide (DMSO) (Sigma-Aldrich, St Louis, long-term SSC culture was created mentally in Missouri, USA), 20% FBS (Invitrogen, Grand which SSCs self-renewing and proliferation Island, USA) and 70% Dulbecco's Modified was promoted in the support of GDNF, Eagle Medium: Nutrient Mixture F-12o (DMEM/F12) as basal media and at -196oC for Epidermal growth factor (EGF) or basic later applications. fibroblast growth factor (FGF2) and presence Frozen testis tissue were defreeze in 37oC of fetal bovine serum (FBS) (11). water bath in 2 min. The tissue was minced by In our study, specific markers have been sterile scissors and dispersed by a two-step identified for SSCs and progenitors in other enzymatic digestion including collagenase species to distinguish hGSCs phenotypes. (type IV, Sigma-C1889) 5 mg/ml and DNase POU domain, class 5, transcription factor 1 1mg/ml for 30 min followed by 0.25% trypsin/1 (POU5F1), also known as Octamer-binding mM EDTA digestion (both from Invitrogen) for transcription factor 4 (Oct -4), a nuclear 10 min. Approximately 2×106 cells were marker for SSCs and progenitor cells gained by this procedure per each tissue expresses in many species such as mouse, pieces (25 mm3). The number of dead cells rat and monkey. 16 Promyelocytic leukemia was generally less than 5% as assessed by zinc finger protein [PLZF, also known as zinc trypanblue staining. finger and BTB domain containing 16 Testicular cells were cultured in StemPro- (ZBTB16)] is a nuclear spermatogonial- 34 SFM (Invitrogen) supplemented with StemPro supplement (Invitrogen), 1 specific marker that is well-known in many nonessential amino acids, 15 mM 4-[2- species (3, 4, 6, 12-15). hydroxyethyl]-1 piperazineethanesulfonic acid The development of the spermatogonial [HEPES], 0.12% sodium bicarbonate, 4 mM L- transplantation technique for therapeutic glutamine (all from Invitrogen), penicillin (100 agents, has given new impetus to research on IU/mL) (Sigma), streptomycin (100 μg/mL) SSCs (16, 17). Because testicular tissues do (Sigma), fangizone 40 μg/mL, insulin 25 not contain sufficient SSCs to fully colonize mg/ml, transferrin 100 mg/ml, putrescine 60 the testis after transplantation, in vitro mM (ITS, Sigma P6024), sodium selenite 30 propagation of hGSCs will be necessary to nM, D-(1)-glucose 6 mg/ml, pyruvic acid 30 obtain an adequate amount of cells for mg/ml, DL-lactic acid 1 ml/ml (Sigma), bovine successful transplantation. Such culture albumin 5 mg/ml (ICN Biomedical, Irvine, methods have been recently developed in CA,USA), L-glutamine 2mM, 2- animal model systems but have thus far not mercaptoethanol 5×10-5 M, minimal essential been reported for hGSCs (11-14). We medium (MEM) vitamin solution (Invitrogen), demonstrated here on an in vitro culture MEM nonessential amino acid solution system that allows for long-term culture and (Invitrogen), ascorbic acid 10-4 M, d-biotin 10 propagation of human spermatogonial stem mg/ml (Sigma B4639), β-estradiol 30 ng/ml 552 Iranian Journal of Reproductive Medicine Vol. 11. No. 7. pp: 551-558, July 2013 Human spermatogonial stem cells culture (Sigma B 2257), progesterone 60 ng/ml Gene expression (Sigma), recombinant human EGF (20 ng/mL) In this study, we applied specificity of PLZF (Sigma-Aldrich), recombinant human GDNF for human germ stem cells to identify these (10 ng/mL) (Sigma-Aldrich-G1777), and cells. Presence of SSCs clusters during the 10ng/mL recombinant human Leukemia entire culture was proved by studding the inhibitory factor (LIF) (Chemicon International expression of spermatogonial genes (18, 19). Inc., Temecula, California, USA) and 10% Total RNA from cultured testicular cells, sub FBS. The cells were incubated at 37oC in 5% cultured germline stem cells and testis tissue carbon dioxide in air. Germ cells were as a positive control was extracted by RNXTM- passaged by short-term trypsination every 10 Plus (CinnaGen Co. Cat No. RN7713C). days at 80-90% confluency to 1 or several Simple Reverse transcriptase polymerase new dishes. We used 2% FBS after 14 days chain reaction (RT-PCR) was carried out by of starting culture to prevent overgrowth of first-strand cDNA synthesize with random fibroblasts. hexamers and the superscript II preamplification system (Invitrogen). Immunohistochemistry Simple RT-PCR reaction was proceeded Immunohistochemistry by using anti human with specific primers for PLZF (ZBTB16) Oct4 (Clone 3B8 B12, Avicenna Research (Forward: 5' GGTCGAGCTTCCTGATAACG Institute, Tehran, Iran) as primary antibody 3', Reverse: 5' CCTGTATGTGAGCGCAGGT was performed. To prepare tissue sections, 3' product size: 149 bp) with master mix kit fresh human tissues were embedded in OCT (Taq DNA polymerase Master mix RED compound in cryomolds and frozen in liquid Amplicon) the annealing temperature (Ta) was nitrogen. Frozen blocks were stored at -80oC. 60oC. GAPDH primer was utilized as DNA Cryostat sections were cut in 4-8 µm improvement (forward: 5' AGAAGCTGGGGC thickness and fixed on slides. Slides were TCATTTG 3', Reverse: 5' AGGGCCATCCAC kept at -80oC until needed. Before ACGTCTTC 3' product size: 129) immunostaining, slides warmed at room temperature for 30 minutes and ice cold Statistical analysis acetone fixation was done for 5 minutes and Statistical analysis was performed by washed in phosphate buffered saline (PBS). ANOVA using SPSS statistical software We prevent non-specific binding by blocking version 2012. Statistically significant with 10% normal serum. Primary antibodies differences (p<0.05) were determined (AB) incubation including mouse monoclonal between Germ line stem cell clusters in first AB to Oct-4 (Clone 3B8 B12, Avicenna and last weeks of culture. Research Institute, Tehran, Iran) at a 1: 50 dilution was performed for 90 min. Results After 3 times washing with PBS, testis sections were incubated with secondary Isolation and culture of Human Germ Stem antibody to FITC-conjugated anti-mouse IgG Cells (hGSCs) from human testis tissues (SPH F301, Avicenna Research Institute, In the initial attempt to isolate human germ Tehran, Iran) at a 1:500 dilution for 45 min. stem cells we obtained testis tissue from a The same washing process was also done. brain dead patient and produced cell The 4', 6'-Diamidino-2-phenylindole (DAPI) suspensions by two step enzymatic was used to stain the nuclei of the cells and digestions. Isolated cells were cultured on the sections were observed for plates in StemPro media supplemented with epifluorescence using an Olympus Fluoview growth factors and 5% FBS to avoid over 500 Laser Scanning Microscope (Olympus, growth of somatic cells as fibroblasts. Melville, NY, USA). Immunocytochemistry was However, although the resulting cells were performed on germ cells after culture for 4 capable of being propagated in vitro, they did weeks. Slides were made ready with cytospin not made colonies up to 2-3 weeks of culture and following steps are like initiating. Following enzymatic dissociation of immunohistochemistry. Replacement of the testis tissue, after approximately 10-14 primary antibody with PBS and IgG was used days of culture, very small colonies as as a negative control. individually clumps of visible cells started to grow on top of the monolayer of testicular Iranian Journal of Reproductive Medicine Vol. 11. No. 7. pp: 551-558, July 2013 553 Akhondi et al somatic cells (Figure 1 A and B). As an determined Oct-4 in sertoli cells or alternative, manual passaging of colonies was differentiated germ cells. A few spermatogonia performed. These colonies could be were detected for Oct-4 in each seminiferous successfully propagated in vitro with tubule cross section (Figure 3, A-C). Normal passaging via trypsin digestion. After ten days mouse IgG and PBS were used as negative colonies arose to the original size and cells controls. Immunocytochemistry revealed that were trypsinized over again. Oct-4 is present in the nucleus of more than These cells, which we have termed human 40% of the isolated human spermatogonia germ stem cells (hGSCs), have been after 6 weeks (Figure 2, D-F). propagated for approximately 6 weeks in vitro presented as colonies with large and round RT-PCR analysis shape (Figure 1 C and D). Statistical analysis RT-PCR was performed to confirm the presented increasing in germ stem cell cluster expression of hGSCs specific gene PLZF numbers from first to 6 weeks of culture (Promyelocytic leukemia zinc finger protein) in (Figure 2) adult human testis and throughout the entire culture period at passages 3 and 6 relative to Immunostaining analysis a normal human testis sample. GAPDH primer In this study for spermatogonial stem cell proved cells presentation during RT-PCR identification, immunohistochemistry was process. performed using Oct-4 as specific marker of Results demonstrated that the hGSCs at these cells. This technique revealed Oct-4 in a passages 3 and 6 express a specific gene subpopulation of spermatogonial nucleus PLZF (Promyelocytic leukemia zinc finger placed on seminiferous tubules basement protein) expressed in the testis, as shown in membrane in adult testis tissue. We did not figure 4. A B C D Figure 1. Germline Stem Cell (GSC) Clusters in vitro culture condition. A, Phase contrast image of cultured human testicular cells before colony formation (7 days after digestion). B, Germ stem cell colonies (arrows) after 2 weeks. C and D, germ stem cell clusters after 4 and 6 weeks of culture. Scale bar 50um. 554 Iranian Journal of Reproductive Medicine Vol. 11. No. 7. pp: 551-558, July 2013 Human spermatogonial stem cells culture Figure 2. Diagram of Germ line stem cells cluster numbers during 6 weeks culture in a 6 well culture dishes (p<0.05). A B C D E F G H I J K L Figure 3. immunofleurescent staining for anti OCT-4 antibody specified for Germline Stem Cells (GSCs). A: Human seminiferous tubules cross sections. OCT-4 positive cells or spermatogonial stem cells are in basement membrane of seminiferous tubules. B: DAPI. C: Merge. D-F: Isolated human spermatogonial stem cells in 6weeks of culture. Arrow shows spermatogonial stem cell. E: DAPI. F: Merge. Arrow heads locate spermatogonial stem cells in seminiferous tubules on basement membrane that was magnified. G: Human testis tissue, Negative control by PBS. H: DAPI. I: Merge. J: Human testis tissue, Negative control by IgG. K: DAPI. L: Merge. Scale bar: 50µm. Iranian Journal of Reproductive Medicine Vol. 11. No. 7. pp: 551-558, July 2013 555 Akhondi et al Negative control AHT 3weeks 6weeks GAPDH 129bp PLZF 149bp 1 2 3 4 Figure 4. RT-PCR representation for spermatogonial stem cells marker PLZF in adult human testis (AHT) tissue in column 2 and after 3 and 6 weeks, column 3 and 4. GAPDH was used as housekeeping gene. Negative control is presented in column 1. Discussion as feeder cells, because these somatic cells are capable of supporting spermatogonial In this study, isolation, culture and cells in culture. We successed to prevent identification of human undifferentiated overgrowthing of adult human somatic cells spermatogonia allows us to characterize these during the culture by adding low concentration putative cells in human testes phenotypically. of FBS (2-5%). We used basal media that formulated to So, GSCs co-culture with somatic cells was support the development of human not inconvenience. Additionally, serial hematopoietic stem cells but later used to passaging motived declination of these cells culture spermatogonial stem cells in other after 6 weeks and they could not support species. In our culture condition human cluster of GSCs as feeder layer. These events spermatogonial stem cells increased in are compatible with Sadri-Ardekani et al number by self-renewal in vitro. Growth results (19). There were two strategies to factors that we used in this culture medium continue the culture according to previous included GDNF, bFGF, EGF, and LIF that studies. First, colonies could be transferred to were able to promote spermatogonial stem plates that coated with mytomycin C- cell survival and proliferation (11). inactivated somatic cells as feeder layer by In this culture condition, germ stem cell allo or autogenic references by non-enzymatic (GSCs) clusters presented as clumps of passaging. So, GSCs could be maintained individually visible cells after 2-4 weeks of and proliferated for a long time. Seandle et al culture initiation. We could characterized them suggested that co-culture of GSCs with by expression of markers as Oct4 and PLZF somatic cells cause induction of multipotency that had been proved as germ stem cell in GSCs by somatic cells after three months markers in many species including human which can form functional differentiated (14, 18, 19). In addition to clusters that tissues (13). Second strategy is to culture presented morphologically and phenotypically GSCs in feeder free plates or laminin-coated being GSCs, we observed another shape of plates. Laminin is secreted by sertoli cells as colonies with compact and sharp edge that an adhesion molecule and bind to ITGα6/β1 were resemble to colonies that called receptors on the surface of spermatogonial embryonic like stem (ES-like) cells in other cells (5). studies (20). Therefore, laminin application in feeder free ES-like cells suggested to be pluripotent culture could perform best condition for and able to convert to all kind of cells of tree maintenance and proliferation of GSCs for a germinal layers. It suggested that ES-like cells long time without change in stem cell potency express embryonic stem cell markers but they (19). However, according to previous studies were negative for PLZF that proved as GSCs epigenetic modification may happen after a marker (21). In contrast to most animal long-term culture of mouse SSCs (22). studies and recent human studies (5, 19). We Although this finding has not been studied in did not eliminate residual testicular somatic human GSCs. Oct-4 has identified the marker cells from the cell suspension and used them of stem cells which can bind to other 556 Iranian Journal of Reproductive Medicine Vol. 11. No. 7. pp: 551-558, July 2013 Human spermatogonial stem cells culture transcription factors such as Sox and FoxD3 cells where it is expressed. Costoya et al or to the promoter or enhancer regions of demonstrated that loss of Plzf function shifts many downstream target genes. This gene the balance between stem cell self-renewal regulates downstream gene expression in and differentiation toward differentiation at the order to maintain the self-renewal of stem cost of self-renewal (24). GS cells also have cells positively or negatively (23). Oct-4 potential clinical value. Patients with expression is exclusively positive in SSCs of malignancies can become infertile following fetal testicular tissue, but negative when treatment with radiation or chemotherapy, differentiated in type B proliferative germ stem cells from a testis biopsy could be spermatogonium. Kubota et al reported that used to increase stem cell numbers before SSCs expressed Oct-4 strongly by using a autologous germ cell transplantation after the green fluorescent conjugated antibody for end of treatment, thereby protecting fertility. labeling (4). They suggested Oct-4 as a useful Thus, GS cells will provide new possibilities in marker for SSCs. biotechnology and medicine (19). In our study, green fluorescent secondary antibody was used for indirect Acknowledgments immunofluorescent. Under a fluorescent microscope, these cells were round and This study was financially supported by consistent with the shape of SSCs with Avicenna research institute and Iranian nucleus staining. Little nonspecific staining council of stem cell technology. could be observed that confirm the efficacy of To masters and administrative staff of Oct-4 labeling for SSCs. Notably, the Avicenna research institute specially Dr A. H. frequency of Oct4-positive cells in human Zarnani, Mrs. Z. Ghaempanah, Mrs. H. testes was low per seminiferous tubule cross- Edalatkhah, Mrs. L. Goharbakhsh and Organ sections and absent in other types of germ Donation Center of Masih Deneshvari Hospital cells and sertoli cells, thus Oct4 will be used masters Dr K. Najafizadeh and Mrs. A. to effectively isolate and purify human type A Rostami. spermatogonia (14). However, studding on characterization of Conflict of interest SSCs by Oct4 specially in human germ cells was very limited (20). So, as presented in our There is no conflict of interest in this study. study, Oct4 as specific marker of human GSCs could be applying for isolation and References identification of these stem cells. To prove these results, it will be necessary to transplant 1. Clermont Y. Renewal of spermatogonia in man. Am J this subpopulation into sterile nude mice testis Anat 1966; 118: 509-524. and study the seeding of these cells to 2. Wu X, Goodyear SM, Tobias JW, Avarbock MR, Brinster RL. Spermatogonial Stem Cell Self-Renewal seminiferous tubules, although the efficiency Requires ETV5-Mediated Downstream Activation of of the xenotransplantation assay of primate Brachyury in Mice. Biol Reprod 2011; 85:1114-1123. germ cells to immunodeficient mouse testes 3. Hofmann MC, Braydich-Stolle L, Dym M. Isolation of need to be explored further (14). PLZF, male germ-line stem cells; influence of GDNF. Dev another spermatogonial stem cells marker Biol 2005; 279: 114-124. 4. Kubota H, Avarbock MR, Brinster RL. Growth factors was studied in our consideration. PLZF as a essential for self-renewal and expansion of mouse spermatogonial stem cell specific transcription spermatogonial stem cells. Proc Natl Acad Sci U S A factor in the testis is required to regulate self- 2004; 101: 16489-16494. renewal and maintenance of the stem cell 5. Kanatsu-Shinohara M, Miki H, Inoue K, Ogonuki N, Toyokuni S, Ogura A, et al. Long-term culture of pool (24). This transcription factor exerts mouse male germline stem cells under serum-or growth-suppressive activities accompanied by feeder-free conditions. Biol Reprod 2005; 72: 985- accumulation of cells in the G0/G1 991. compartment of the cell cycle. Thus, PLZF is 6. Hermann BP, Sukhwani M, Lin CC, Sheng Y, Tomko thought to regulate directly the epigenetic J, Rodriguez M, et al. Characterization, cryopreservation, and ablation of spermatogonial repression of chromatin domains required for stem cells in adult rhesus macaques. Stem Cells cell differentiation. 2007; 25: 2330-2338. Our studies support the hypothesis that 7. Clermont Y. The cycle of the seminiferous epithelium Plzf maintains the undifferentiated state in in man. Am J Anat 1963; 112: 35-51. Iranian Journal of Reproductive Medicine Vol. 11. No. 7. pp: 551-558, July 2013 557 Akhondi et al 8. Clermont Y. Spermatogenesis in man. A study of the 17.Brinster RL, Zimmermann JW. Spermatogenesis spermatogonial population. Fertil Steril 1966; 17: following male germ-cell transplantation. Proc Natl 705-721. Acad Sci USA 1994; 91: 11298-11302. 9. Clermont Y. Kinetics of spermatogenesis in 18. Dann CT, Alvarado AL, Molyneux LA, Denard BS, mammals: seminiferous epithelium cycle and Garbers DL, Porteus MH. Spermatogonial stem cell spermatogonial renewal. Physiol Rev 1972; 52: 198- self-renewal requires OCT4, a factor downregulated 236. during retinoic acid-induced differentiation. Stem 10. Dym M, Kokkinaki M, He Z. Spermatogonial stem Cells 2008; 26: 2928-2937. cells: mouse and human comparisons. Birth Defects 19. Sadri-Ardekani H, Mizrak S, van Daalen S, Korver C, Res C Embryo Today 2009; 87: 27-34. Roepers-Gajadien H, Koruji M, et al. Propagation of 11. Kanatsu-Shinohara M, Ogonuki N, Morimoto H, Human Spermatogonial Stem Cells In Vitro. JAMA Ogura A, Shinohara T. Serum- and feeder-free 2009; 302: 2127-2134. culture of mouse germline stem cells. Biol Reprod 20. Avarbock MR, Brinster CJ, Brinster RL. 2011; 84: 97-105. Reconstitution of spermatogenesis from frozen 12. Hermann BP, Sukhwani M, Simorangkir DR, Chu T, spermatogonial stem cells. Nat Med 1996; 2: 693- Plant TM, Orwig KE. Molecular dissection of the male 696. germ cell lineage identifies putative spermatogonial 21. Mizrak SC, Chikhovskaya JV, Sadri-Ardekani H, van stem cells in rhesus macaques. Hum Reprod 2009; Daalen S, Korver CM, Hovingh SE, et al. Embryonic 24: 1704-1716. stem cell-like cells derived from adult human testis. 13. Seandel M, James D, Shmelkov SV, Falciatori I, Kim Hum Reprod 2010; 25: 158-167. J, Chavala S, et al. Generation of functional 22. Kanatsu-Shinohara M, Ogonuki N, Iwano T, Lee J, multipotent adult stem cells from GPR125+ germline Kazuki Y, Inoue K, et al. Genetic and epigenetic progenitors. Nature 2007; 449: 346-350. properties of mouse male germline stem cells during 14. He Z, Kokkinaki M, Jiang J, Dobrinski I, Dym M. long-term culture. Development 2005; 132: 4155- Isolation, characterization, and culture of human 4163. spermatogonia. Biol Reprod 2010; 82: 363-372. 23. Ebata KT, Yeh JR, Zhang X, Nagano MC. The 15. Meng X, Lindahl M, Hyvönen ME, Parvinen M, de application of biomarkers of spermatogonial stem Rooij DG, Hess MW, et al. Regulation of cell fate cells for restoring male fertility. Dis Markers 2008; 24: decision of undifferentiated spermatogonia by GDNF. 267-276. Science 2000; 287: 1489-1493. 24. Costoya JA, Hobbs RM, Barna M, Cattoretti G, 16.Brinster RL, Avarbock MR. Germline transmission of Manova K, Sukhwani M, et al. Essential role of Plzf in donor haplotype following spermatogonial maintenance of spermatogonial stem cells. Nat transplantation. Proc Natl Acad Sci USA 1994; 91: Genet 2004; 36: 653-659. 11303-11307. 558 Iranian Journal of Reproductive Medicine Vol. 11. No. 7. pp: 551-558, July 2013