Logout succeed
Logout succeed. See you again!

Presence of Archaea in the Indoor Environment and Their Relationships with Housing Characteristics PDF
Preview Presence of Archaea in the Indoor Environment and Their Relationships with Housing Characteristics
Presence of Archaea in the Indoor Environment and Their Relationships with Housing Characteristics The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Pakpour, Sepideh, James A. Scott, Stuart E. Turvey, Jeffrey R. Brook, Timothy K. Takaro, Malcolm R. Sears, and John Klironomos. “Presence of Archaea in the Indoor Environment and Their Relationships with Housing Characteristics.” Microbial Ecology 72, no. 2 (April 20, 2016): 305–312. As Published http://dx.doi.org/10.1007/s00248-016-0767-z Publisher Springer US Version Author's final manuscript Accessed Sat Apr 06 05:17:49 EDT 2019 Citable Link http://hdl.handle.net/1721.1/103800 Terms of Use Article is made available in accordance with the publisher's policy and may be subject to US copyright law. Please refer to the publisher's site for terms of use. Detailed Terms April 3, 2016 Subject: Revised Paper Submission to Microbial Ecology (paper ID: MECO-D-15-00514R1) Manuscript Title: Presence of Archaea in the indoor environment and their relationships with housing characteristics Authors: Sepideh Pakpour, James A. Scott, Stuart E. Turvey, Jeffrey R. Brook, Timothy K. Takaro, Malcolm R. Sears, and John Klironomos Dear Dr. Nelson, Following our recent communication and your advice, enclosed please find a copy of our revised manuscript (MECO-D-15-00514R1) that we are submitting for potential reconsideration in Microbial Ecology. Below I have also included the authors’ responses to each of the respected reviewer’s latest comments, which have been accordingly applied in the enclosed text file (yellow highlights). In particular following the reviewer 3 comment we included the new reference [36]. Thank you very much again for giving us the opportunity to submit this revised version. Sincerely, Sepideh Pakpour, PhD Postdoctoral Fellow Broad Institute-Department of Biological Engineering-MIT Center for Health and the Global Environment, Harvard T.H. Chan School of Public Health Phone: 617-714-7763 Email: [email protected] or [email protected] Reviewer 1 -The authors adequately addressed my previous concerns. > Thank you very much again for your time. Reviewer 2 -Authors have made all corrections suggested by reviewers. however, reference list is not added in the revised version, therefore reviewer cannot verify the corrections. > Thank you very much again for your time. This has been merely an unfortunate incident as the 1 list was deleted during the upload and we added the complete reference list in this revised version. -On line numbers 110 and 113, duration for denaturation should be 30 Sec not 3 seconds. > Corrected. Reviewer 3 -The only type of measurement that was made in this work was quantitative PCR of 16S rRNA genes. Therefore, it is particularly crucial to make sure that the methodology worked well, because otherwise there is nothing left in the report. Here, the reference for the primers in the qPCR method for Archaea is Guo et al. 2013, which is not a methodology paper on qPCR of Archaea. In their paper, Guo et al. 2013 cite Burggraff et al. 1997 and Groβkopf et al. 1998 for the qPCR primers. The paper by Burggraff et al. 1997 deals with Archaea phylogeny, without any qPCR. The paper by Groβkopf et al. 1998 deals with methanogen diversity in soil, here again without any qPCR. In summary, nobody seems to have ever validated the current primers for qPCR of Archaea. In my opinion it is just not possible to base an entire paper on the use of a qPCR method that has not been validated. And sometimes the mere fact of changing the qPCR machine can alter the validity of qPCR data > Thank you very much again for your time and constructive argument. We also agree that the primer and qPCR workflow validation is a crucial step before running any experiments. Apart from Guo et al. 2013, Kemnitz et al. [cited below and also included in the new revised text (Ref [36])] measured total numbers of archaea by qPCR targeting the 16S rRNA gene using the primer combination A364aF/A934b and A109f/A934b. They specifically noted that A364aF/A934b combination proved to be more specific than the combination A109f/A934b, and it did not result in any unspecific amplification of bacterial 16S rRNA genes. **Kemnitz D, Kolb S, Conrad R (2005) Phenotypic characterization of Rice Cluster III archaea without prior isolation by applying quantitative polymerase chain reaction to an enrichment culture. Environmental Microbiology 7: 553-565. doi: 10.1111/j.1462-2920.2005.00723.x It may also be worth noting that this set of primers has been cited in other literatures; some examples have been listed below: **Zheng YM, Cao P, Fu BJ, Hughes JM, He JZ (2013) Ecological Drivers of Biogeographic Patterns of Soil Archaeal Community. PLoS One 8. doi: 10.1371/journal.pone.0063375 **Shen JP, Cao P, Hu HW, He JZ (2013) Differential response of archaeal groups to land use change in an acidic red soil. Science of the Total Environment 461: 742-749. doi: 10.1016/j.scitotenv.2013.05.070 **Cao P, Zhang LM, Shen JP, Zheng YM, Di HJ, He JZ (2012) Distribution and diversity of archaeal communities in selected Chinese soils. FEMS Microbiology Ecology 80: 146-158. doi: 10.1111/j.1574-6941.2011.01280.x 2 The authors would also like to share with the respected reviewer that prior to running the tests on dust samples, the same set of primers and the qPCR workflow were widely tested by other students in the UBC lab on the cloned archaeal sequences (positive controls), other samples (e.g., soil) with spiked cloned archaeal sequences (positive controls), and samples (with no internal reference). Result of their sequencing showed no unspecific amplicons. -The authors speculate that the DNA of the Archaea species may be present in air fresheners, and this could have been tested readily. The authors answer that they do not have access to these air fresheners. Does it mean all these families have moved outside of the area so that it is not possible to contact them again? Have local stores ceased to sell these products? The use of fresheners was based on a ‘yes/no’ survey question and the authors did not have permission to contact the recruited families as part of the mini-child study privacy agreement to get more specific information. Though, this speculation can be a good step for future studies, yet if you advise we can remove the corresponding sentence from the manuscript. 3 Presence of Archaea in the indoor environment and their relationships with housing characteristics Sepideh Pakpour1,2, James A. Scott3, Stuart E. Turvey4,5, Jeffrey R. Brook3, Timothy K. Takaro6, Malcolm R. Sears7, and John Klironomos1 1 Department of Biology, University of British Columbia, Kelowna, BC, Canada 2 Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA, USA 3 Dalla Lana School of Public Health, University of Toronto, Toronto, ON, Canada 4 Department of Pediatrics, University of British Columbia, Vancouver, BC, Canada 5 Child & Family Research Institute, BC Children’s Hospital, Vancouver, BC, Canada. 6 Faculty of Health Sciences, Simon Fraser University, Vancouver, BC, Canada 7 Faculty of Health Sciences, McMaster University, Hamilton, ON, Canada Keywords: Archaea, Bacteria, Indoor Environment, qPCR, Building Characteristics, Human Activities 4 Abstract Archaea are widespread and abundant in soils, oceans, or human and animal gastrointestinal (GI) tracts. However, very little is known about the presence of Archaea in indoor environments and factors that can regulate their abundances. Using a quantitative PCR approach, and targeting the archaeal and bacterial 16S rRNA genes in floor dust samples, we found that Archaea are a common part of the indoor microbiota 5.01±0.14 (log 16S rRNA gene copies / g dust, Mean ±SE) in bedrooms and 5.58±0.13 in common rooms, such as living rooms. Their abundance, however, was lower than for bacteria; 9.20±0.32 and 9.17±0.32 in bedrooms and common rooms, respectively. In addition, by measuring a broad array of environmental factors, we obtained preliminary insights into how the abundance of total archaeal 16S rRNA gene copies in indoor environment would be associated with building characteristics and occupants’ activities. Based on our results, Archaea are not equally distributed within houses, and the areas with greater input of outdoor microbiome and higher traffic and material heterogeneity tend to have a higher abundance of Archaea. Nevertheless, more research is needed to better understand causes and consequences of this microbial group in indoor environments. 1. Introduction The biology and ecology of the third domain of life, Archaea, have been studied far less when compared to the other domains including Bacteria, and Eukarya. Archaea are microorganisms discovered in the late 1970s [1]. For years after their discovery, scientists believed that Archaea were restricted to extreme environments, such as deep-sea 5 hydrothermal vents, hypersaline waters, or strictly anoxic ecosystems [2]. Development of culture-independent molecular techniques and high-throughput molecular sequencing approaches transformed this belief by illustrating their presence, often with high abundance and diversity, in terrestrial and aquatic environments [3-5], animal care facilities [6-8], deteriorated medieval wall paintings [9], as well as the human and animal microbiome such as gastrointestinal (GI) tracts [10-14] and human oral cavities [15]. However, the presence of Archaea in many other ecosystems has still been investigated scarcely and our understanding of their role in their habitat is limited. One such overlooked ecosystem is the indoor built environment. There is significant ongoing interest in better understanding the “built environment microbiome” [16], with a focus on characterizing microbial diversity as well as the environmental parameters that would drive its patterns [16-26]. Nevertheless, most of the past studies on the indoor microbiome considered mainly bacteria [16, 17, 27-30], and to a lesser degree fungi [19, 20, 23, 25, 31, 32]. Here, we used culture-independent molecular approaches to study the archaea in indoor dust from homes in the so-called “miniCHILD” study – which is a preliminary cohort of 54 homes in the Vancouver area recruited to assist in the optimization and validation of data collection tools for the larger Canadian Healthy Infant Longitudinal Development (CHILD) study [33, 34]. We sought to answer three general questions: (1) are Archaea regular components of built environment microbiomes? If yes, (2) what would be their magnitude compared to indoor bacteria? And (3) how would building characteristics and occupants’ activities relate to the variation of archaeal abundances? 6 2. Material and Methods 2.1 Sample Collection Between May 2008 and May 2009, trained research assistants collected dust from the homes of families with new born children using a sterile, depyrogenated custom-designed aluminum collection device attached to the end of a vacuum cleaner (Model S3680, Sanitaire Canister Vac, Charlotte, NC, USA). The collection device held two nylon DUSTREAM filters (Indoor Biotechnologies Inc, Charlottesville, VA). Two dust samples were collected in each house; the first sample was a composite of the mattress and floor in the room where the subject child slept, and the second sample was collected from the floor of the room occupied most often by the family. A standardized floor area was initially sampled (2 m2) and if insufficient dust was obtained, the sampling area was expanded. Research technicians visually observed the thimbles after vacuuming 2 m2; if the thimbles were less than half-full, the technician continued vacuuming in a new area of the room until the required amount was met. The exact size of the vacuumed area was recorded for all samples taken. Samples were then fractionated using a sterile depyrogenated 100 Mesh sieve (~150 µm), and the fine fraction transferred to a sterile depyrogenated borosilicate glass vial with a Teflon-lined screw cap (VWR 1 dram glass vial, West Chester, PA) and stored at -80 °C until analysis. 2.2 DNA extraction and quantitative PCR analyses Total DNA was extracted from 100 mg of collected fine dust samples using a FastDNA® SPIN Kit for Soil (MP Biomedicals, LLC, Solon, OH, USA), which was selected systematically by using the Order Preference by Similarity to Ideal Solution (TOPSIS) 7 method [35] as the most optimum extraction kit for dust samples in the present case study. Subsequently, extracted DNA samples were checked for integrity by agarose gel electrophoresis with Lambda DNA HindIII Digest standards (New England BioLabs, Ipswich, MA, USA) and their quantities were measured using the QuantiFluor® dsDNA System (Promega, Madison, WI, USA). The purity of extracted DNA samples was evaluated by measuring each sample’s ratio of the optical density at 260 nm and 280 nm using the NanoVue Plus™ spectrophotometer (GE Healthcare, Buckinghamshire, UK), before preserving them at –20 °C. Abundances of both archaeal and bacterial 16S rRNA gene copy numbers were measured by quantitative PCR (qPCR); using A364aF (5’ CGGGGYGCASCAGGCGCGAA 3’) and A934bR (5’ GTGCTCCCCCGCCAATTCCT 3’) primers for Archaea [36] and BACT1369F (5’ CGGTGAATACGTTCYCGG 3’) and PROK1492R (5’ GGWTACCTTGTTACGACTT 3’) for bacteria [37]. Although the abundance of 16S gene sequences is not a surrogate measure of the relative abundance of the archaeal and bacterial cells containing those sequences (because of variations in genomic copy number of the 16S gene in microbial species), in the rest of this manuscript for the sake of brevity, 16S rRNA gene copy numbers will be referred to as archaeal/ bacterial abundances. All PCR amplifications were carried out in a CFX96 Touch™ Real-Time PCR Detection System (BioRad, Ontario, Canada) and each PCR reaction mixture (20 µL) contained 10 µL of SsoFast™ EvaGreen® Supermix (Biorad, Hercules, CA), 1.5 µL of 1000 µg/ µL T4 gene 32 protein (Biolabs, Ipswich, MA), 0.4 µM of each primer, nuclease-free water (IDT, Coralville, IA, USA), and 2 µL of extracted DNA (5 ng / µL). Thermal-cycling conditions for 16S Archaea were as follows: 95°C for 2 min for the enzyme activation, 40 8 cycles of 95°C for 30s (denaturation) and 61.5°C for 30s (annealing and extension), followed by 1 cycle of melting analysis (65 – 95°C (0.1°C / 2s)). These conditions for 16S Bacteria included: 95°C for 2 min for the enzyme activation, 40 cycles of 95°C for 30s (denaturation) and 56°C for 30s (annealing and extension), followed by 1 cycle of melting analysis (65 – 95°C (0.1°C / 2s)). Standard curves were obtained using three replicates of 1:10 serial dilutions of linearized plasmids containing both cloned archaeal and bacterial 16S rRNA sequences, giving a concentration range from 10 to 106 copies/ µL. Amplification efficiencies of 92.2 – 94.7 % (R2 > 0.985) and 90.1 – 105.8 (R2 > 0.963) were observed for archaeal and bacteria standards, respectively. Finally, melting curve analyses at the end of all qPCR runs and agarose gel running of qPCR products were performed to check for amplification and specificity of the products. 2.3 Collection of environmental variables and statistical analyses We monitored and recorded 668 housing characteristics as well as building inhabitant activities by using standardized questionnaires and direct on-site visits for the purpose of statistical analyses. An exhausted list of these factors have been described in recent publications [33, 34] and a subset is shown in Table 1. The questionnaire was comprised of questions on the location, history, and characteristics of the unit, such as basic house dimensions, construction details of the building envelope, furniture materials and finishes for interior designs, the occurrence of factors which could influence moisture sources and air change as well as number, type and activities of the occupants. 9