loading

Logout succeed

Logout succeed. See you again!

ebook img

Paraphyly of the Enoplognatha ovata Group (Araneae, Theridiidae) Based on DNA Sequences PDF

pages8 Pages
release year1999
file size7.9 MB
languageEnglish

Preview Paraphyly of the Enoplognatha ovata Group (Araneae, Theridiidae) Based on DNA Sequences

1999. The Journal of Arachnology 27:481-488 PARAPHYLY OF THE ENOPLOGNATHA OVATA GROUP (ARANEAE, THERIDIIDAE) BASED ON DNA SEQUENCES A.-M. Tan‘, R.G. Gillespie' and G.S. Oxford^: ^Center for Conservation Research and Training, University of Hawaii, 3050 Maile Way, Gilmore 409, Honolulu, Hawaii 96822, USA; ^Department of Biology, University of York, RO. Box 373, York YOl 5YW, UK ABSTRACT: Five species of Enoplognatha Pavesi 1880 were recently recognized as a monophyletic Enoplognatha ovata group based on morphological data. We analyzed the E. ovata clade for monophyly using four species in the E. ovata group {E. ovata (Clerck 1757), E. latimana Hippa & Oksala 1982, E. margarita Yaginuma 1964 and E. afrodite Hippa & Oksala 1983) and three other closely related taxa {E. japonica Bosenberg & Strand 1906, E. thoracica (Hahn 1833), and E. intrepida Sprensen 1898). Two species ofthe presumed sister genus (Steatoda Sundevall 1833) were employed as outgroups. The results indicate that the ovata clade” is not monophyletic. The genus Enoplognatha Pavesi 1880 is (Hippa & Oksala 1979, 1981; Oxford 1983, & characterized by the presence of a large col- 1985, 1989, 1991, 1992; Oxford Reillo ulus, a plesiomorphic character for the family; 1993; Reillo & Wise 1988a, b). Consistent and accordingly, the genus is generally con- with most invertebrate color polymorphisms sidered one of the more primitive groups in (Haldane 1939) the dominance hierarchy of the Theridiidae. The spiders are medium-to- the expression of morphs in E. ovata follows large sized with a subspherical abdomen. Fe- the inverse of morph frequencies in nature, males have a tooth on the posterior margin of i.e., the least dominant (or most recessive) al- the chelicerae; males usually have enlarged lele is most frequent; the most dominant is the chelicerae, with enlarged teeth on the poste- rarest. For the mode of inheritance of the rior margin, and have the paracymbium on the polymorphism in E. ovata, Oxford (1983) has margin of the cymbium. The genus is very proposed a two locus model: one locus is con- close to Steatoda Sundevall 1833, medium-to- cerned with pattern and color, the other with large sized spiders, again characterized by a the regulation of this color locus during de- very large colulus (Levi 1962; Levy & Amitai velopment. When red-pigmented alleles are 1981). The chelicerae are often enlarged in linked to the late developing allele, the color males, and have one or more teeth on the an- morphs are sex-limited: males are lineata no terior margin, none on the posterior margin. matter which allele they carry. Enoplognatha Enoplognatha is well known because ofthe latimana Hippa & Oksala 1982 shares color, striking color and pattern polymorphism ex- regulatory, and black spotting polymorphisms hibited by representative species in the genus, with E. ovata (Oxford 1992), although E. la- which has been most intensively studied in E. timana lacks the ovata color morph. ovata (Clerck 1757). Three distinct morphs In the 1980s Hippa & Oksala (1982) erect- have been described in E. ovata (Locket & ed the E. ovata group to include E. ovata sen- Millidge 1951; Hippa & Oksala 1979; Oxford su stricto, E. latimana, and E. penelope Hippa 1976): lineata (all yellow), redimita (yellow & Oksala 1982. Members of the group share with two dorsolateral carmine stripes on the the following characters: trichobothrium on abdomen), and ovata (yellow with a solid the first metatarsus subapical; elongated, shield of carmine on the dorsal surface of the sclerotized and subtubular tip of conductor in abdomen). The color pattern variation in E. male palp; female vulva with massive copu- ovata is genetically determined, and has been latory pockets and abdomen with sharply de- the subject of numerous studies on the genet- limited dorsolateral black spots (Hippa & ics and evolution of the color polymorphism Oksala 1982). Further examination ofmaterial 481 482 THE JOURNAL OF ARACHNOLOGY from Europe and Japan added another two METHODS & — species to theE. ovata gro&up (Hippa Oksala Spiders sequenced. Enoplognatha: E. 1983): E. afrodite Hippa Oksala 1983 and ovata, two individuals from two localities: E. margarita Yaginuma 1964. E. margarita Grimes Graves, Norfolk, U.K., collected by shares the subapical trichobothria and sclero- G.S. Oxford, June 1991; and Berceto, Italy, tized subtubular tip of the conductor with E. collected by G.S. Oxford & RR. Reillo, Au- ovata, E. latimana and E. penelope. However, gust 1991. E. latimana, one individual: it lacks the massive copulatory pockets. Con- Grimes Graves, Norfolk, U.K., collected by sidering all of these characters as synapomor- & G.S. Oxford, June 1991. E. afrodite, one in- phies, Hippa Oksala (1983) hypothesized dividual: near Carcassonne, S. France, col- that E. margarita was the closest sister to {E. ovata + E. latimana + E. penelope). Eno- lectedby S. Peet, July 1988. E. margarita, one individual: Nukabira, Kamishihoro-cho, Hok- plognatha afrodite has a similar body shape, kaido, Japan, collected by M. Matsuda, Au- ground color and spotting pattern to (E. ovata gust 1992. Other Enoplognatha species ex- + E. latimana + E. margarita) butlacks these synapomorphies. Accordingly, Hippa & Oks- amined: E. japonica, one individual: Hokkaido, Japan, collected by M. Matsuda, ala considered E. afrodite as the most ances- July 1989; E. thoracica, one individual: Flat- tral species in the group. More recently, Oxford & Reillo (1994) ford Mill, Suffolk, U.K., collected by C.J. Smith, May 1978; E. intrepida, one individ- questioned the phylogeny of the E. ovata group proposed by Hippa & Oksala. Their ual: Third Hill Mountain, Berkeley County, concern arose because E. ovata, E. latimana, West Virginia, USA, collected by P.J. Martin- E. penelope and E. afrodite all have European aStm.iMthasyoni1a9n8,6 (Mdeuts.eDu.mT JoefnniNnagtsu,radlepHoissittoerdy)i.n distributions (although the former two have We also extracted DNA fromE. penelope, one been introduced into North America). All oc- individual: Sami, Kefallinia, Greece, collected cur in the Mediterranean region; but only E. latimana and E. ovata occur further north, by J. Murphy, May 1987. However, we were not successful in amplifying the product. Out- with E. ovata alone extending well into north- ern Europe. Based on this distributional infor- groups: We used two species of Steatoda as mation, Oxford & Reillo hypothesized a pos- the outgroup: Steatoda grossa: Molokai, Ha- sible Mediterranean origin of the E. ovata waii, collected by A.-M. Tan & G.S. Oxford group, suggesting that the Asian E. margarita October 1993 and S. bipunctata: Yorkshire, may have been phylogenetically misplaced by U.K., collected by G.S. Oxford, January 1994. Hippa & Oksala. Indeed, the phylogeny pre- Voucher specimens for all species used are at sented by Hippa & Oksala was open to criti- the Center for Conservation Research and cism because of the lack of a suitable out- Training, University of Hawaii. — group for character polarization, few (only DNA extraction and sequencing. DNA nine) characters used, and because there was samples were prepared by the conventional no quantitative assessment of phylogeny. SDS-NaCl-Ethanol method (Medrano et al. In the current study we examined four spe- 1990; Tan & Orrego 1992). Tissues from the cies in the E. ovata group, and three other legs or prosoma were placed in a 1.5 ml tube species of Enoplognatha: E. japonica Bosen- and ground with a pipette tip. After adding 15 berg & Strand 1906 from Japan, E. thoracica p.1 ofproteinase K, the tissues were incubated (Hahn 1833) from England, and E. intrepida at 55 °C overnight. Proteins were removed by Sprensen 1898 from North America. As out- salt precipitation. DNA was precipitated, groups in the analysis we used two species of washed in alcohol and preserved in IX TE Steatoda: S. grossa (C.L. Koch 1838) and S. buffer (pH 8.0). bipunctata (Linnaeus 1758). We examined the For both double and single stranded PCR pattern of sequence evolution in the E. ovata amplification we used the following primers group to ascertain the monophyly ofthe clade. (Table 1): E and B2 for the less variable re- In this way we can evaluate the hypothesis gion of the 18S sequence; B and P for the A that the Mediterranean served as the center of more variable region of the 18S sequence; origin for the group as suggested by Oxford and B2 for the 16S sequence. PCR amplifi- & Reillo (1994). cation of double-stranded products was per- TAN ET AL.—PARAPHYLY OF ENOPLOGNATHA OVATA GROUP 483 — Table 1. Primers used. Position obtained refers to Drosophila (Clary & Wolstenholme 1985). Gene Primer sequence in Position # Base primer Drosophila obtained pairs Reference 18S E CTGGTTGATCCTGCCAGTAG 24-553 529 modified from 18S B2 GCTGGCACCAGACTTGCCCTCC Hillis & Dixon 1991 18S B TTCCAGCTCCAATAGCGTAT 606-916 325 W.C. Wheeler& C. Hayashi, 18S P GTCTTGCGACGGTCCAAGA pers. comm. 16S A CGCCTGTTTATCAAAAACAT 12864-13417 450 S.R. Palumbi & T. Hsiao, 16S B2 CTCCGGTTTGAACTCAGATCA pers. comm. formed in 12.5 jx! volume with 38 cycles us- hood (ML) in PHYLIP (version 3.5c, Felsen- ing Thermus aquaticus DNA polymerase stein 1993), using a generalized Jukes & Can- (Saiki et al. 1985). Amplification was done tor (1969) model to allow for unequal base with the following profile: 93 °C, 50 °C and frequencies (Felsenstein 1981) as well as dif- 72 °C each for 30 seconds. Single strandprod- ferent rates of transitions and transversions. ucts were prepared by asymmetric PCR (Gyl- Sequences were also analyzed by Maximum lensten & Erlich 1988) with 1:50 primerratios Parsimony (MP) in PAUP (version 3.1.1, in 50 p,l volumes and the same reaction pro- Swofford 1993). In both analyses gaps were files as above. The products were assessed by treated as nrussing data. Bootstrap analyses mini-gel electrophoresis using 5 |xl aliquots, (Felsenstein 1985) were used to estimate the and washed in sterilized distilled water with statistical confidence of the different nodes in MC three cycles of dialysis using Millipore the trees. 30 (Amicon Corp.). Dideoxy chain termina- RESULTS tion sequencing (Sanger et al. 1977) was per- formed using the US Biochemicals Sequenase The aligned sequences of the 18S region version 2.0 kit and ^^S labeled dATP. Negative (Fig. 1) and 16S region (Fig. 2) are shown for controls were used in all PCR amplifications each species (the two specimens of E. ovata to make sure the sequences were not from were identical in sequence). Except for E. contaminated sources. Sequences were con- thoracica (18S only) and E. intrepida (16S firmed by resequencing the same strand from only) we obtained 18S and 16S sequence for another PCR product. — all species used. The data were first analyzed Phylogenetic analysis. Ribosomal se- separately to determine the degree of congru- quences were initially aligned using the pro- ence. The 18S sequences showed little bias in gram SeqEd 1.0.3 (AppliedBiosystems 1995), base composition, and no evidence for a tran- ML after which alignment of multiple sequences sition: transversion (TS:TV) bias. The W was optimized in CLUSTAL 1.4 (Higgins tree (using a TS:TV ratio of 1:1) was similar & Sharp 1988) in SeqPup 0.6 (Gilbert 1996). to the MP tree (using a branch-and-bound The entire first sequence is optimally aligned search) (Fig. 3A): {E. thoracica + E. marga- with the second entire sequence, with mis- rita) and {E. latimana + E. ovata) were both matches, gaps and insertions penalized equal- discrete clades, and E. japonica fell outside ly, and with an additional gap length penalty all other species of Enoplognatha. The only for each residue in the insertion. Subsequent difference between the analyses was that E. detailed alignment was by eye using the sec- afrodite was placed with {E. thoracica + E. ML ondary structures (Kjer et al. 1994). The 18S margarita) in the tree, while its position sequences were aligned against the secondary relative to {E. thoracica + E. margarita) and structure of Eurypelma californica to match (F. latimana + E. ovata) was unresolved in MP multiple sequences against conserved regions the tree. Constraining E. ovata, E. lati- (Hendriks et al. 1988). The 16S sequences mana, E. margarita and E. afrodite to be were aligned against Drosophila yakuba monophyletic increased the length of the MP (Clary & Wolstenholme 1985), using the sec- tree by two steps. We tested the monophyly ondary structure of the region. Sequences ofE. ovata, E. latimana, E. margarita and E. were first analyzed using Maximum Likeli- afrodite by calculating likelihood values (Fel- .. 484 THE JOURNAL OF ARACHNOLOGY E. ovata XXXXAAAGATTAAGCCATGCATGTCTAAGTACATGCCGTATTAAGGCGAAACCGCGAATGGCrCATTAMTCAGTTATGGTTCCTTAGATCGTACCTTACTACTTGGATAACTGTGGCAATTCT E. latimana xxxx E. afrodite xxxxxxxxxxxxxxxxxxxxx E. japonica xxxxxxxxxxx E. margarita xxxxxxxxxxxxxxxxxxxx E. thoracica xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Steatoda h. TCTC AA G Steatoda g. XXXXXXXXXXXXXXXX G E. ovata AGAGCTAATACATGCAGCAGAGCTCCGACCTTr*GGGA(XAGCGCTTrTATTAGACCAATACCAATCGGGCCTCGTGTCCGTTC'IGTGTGGTGACTCTGTATAACTTTGGGCTGATCGCACGQG E. latimana EESEE....teamajttaafhorprodogoranadairiccitbi.atecaa GGGC* AAAA............AAAGA A G AATCTTA Steatoda g. CAC A A.T...G TCA A A E. ovata CTCGTCCCGGCGACGTATCTTTCAAGTGTCTGCCTTATCAACTGTCGATGGTATGTTACGCGCCTACCATGGTCGTAACGGGTAACGGGGAATCAGGGTTCGATTCCaSAGAGGGAGCCTGAGA E. latimana E. afrodite E. japonica EE.. mtahrograarciitcaa •G. Steatoda b. Steatoda g. E. ovata AACGGCTACCACATCCAAGGAAGGCAGCAGGCGCGCAAATTACCCACTCCAGAACGGGGAGGTAGTGACGAAAAATAACAATACGGGACTCT'ITTGAGACCCCGTAATTGGAATGAGTACACTC E. latimana E. afrodite G E. japonica G XX E. margarita G.C C E. thoracica G.C C XXXXXXXX Steatoda b. G Steatoda g. G E. ovata TAAATCCTTTAAXX/////XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTCGTCCTCCTACCGGTGGTTACTGCCCGCGCTGAACGAATCAGCCGGTTTCCTT E. latimana CX/////XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX EE.. ajafproondiictae XXXXXXXXXXxXxXxXxX//////////XXXXXXXXXXXXXXXXXXXTXGXCXGXGXTXTXAXAXAXAXAXGXCXTXCXGXTAXGXTXTXGXGXAATTCCTTCCAAGGTTTTCCCCAAGGCCCTGGGGGG.G A C T.T A.CAAC E. margarita XXXXXXXXXX/////XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX E. thoracica XXXXXXXXXXXXXX/////XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX SStteeaattooddaa bg.. XXXXXXXXXCAX//////////XTXAXAXAXGXTXTXGXTXTXGXCXGXGXTXTXAXAXAXAXAXGXCTTCCGGTTAAGGTTTTGGGGAATTCCTTCCAAGGTTTTGGCCAAGGAAGGGGGGAACCGG CC TT..TTTTTTTT *TTCCA TTCC E. ovata T3ATGATCTTCATCGGTTGTCTTGGGTGACCGGCA'»GTTTACTTTGAAAAAATTAGAGTGCTCAAAGCATACGTGA*CGCATGAATAATGGTGCATGGAATAATGGAATAGGACCTCGGTTCTA E. latimana E. afrodite xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx EE.. jmaaprognairciata T A*T G C...aG*.-*-...AAT..X C, E. thoracica A G* A Steatoda b. C xxxxxxxxxxxx xxxxxxxxxxxxxxxxxx Steatoda g. C A G » E. ovata TTTTGTTGGTTTTCGGAACACGAGGTAATGATTAAGAGGGACAXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX E. latimana xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx E. afrodite XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX E. japonica GACGTGGTCATTCGTACTGCGACGCTAGAGGT3AAATTGTTGG E. margarita xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx E. thoracica xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Steatoda b. A A xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx Steatoda g. A A GCCGGGGGCATTCGTACTGCGACGCTAGAGGTGAAATXXXXXX — Figure 1. Comparison ofnuclear 18S ribosomal DNA sequences from 6 species ofEnoplognatha and Steatoda bipunctata and S. grossa. Dots represent positions that are identical in sequence to the top sequence; asterisks represent gaps in the sequence required to maximize alignment; crosses indicate no data for a region. The sequence begins at position 24 in Drosophila and ends at position 916. The area marked by ///// indicates the end of the more conserved region of the 18S sequence (position 553 in Drosophila) and the beginning ofthe more variable region (position 606 in Drosophila). sensteie 1988) for phylogenies that forced when E. ovata, E. latimana, E. margarita and these taxa to be monophyletic: PHYLIP was E. afrodite were constrained to be monophy- used to perform a statistical test of each of letic (log likelihood —1577.8). these trees against the one with highest like- The 16S sequences show a heavy AT bias, lihood. This test uses the mean and variance and accordingly most of the changes were of log-likelihood differences between trees, A<~>T transversions. The ML analysis was taken across sites (Kishino & Hasegawa based on a model which uses the empirical 1989); trees are considered significantly dif- frequencies ofthe bases observed in the input ferent if their means differ by more than 1.96 sequences, and thus accommodates biases in standard deviations. The log likelihood value AT richness. Using TS:TV ratios of 1:1 and for the best tree was -1574.9, and was not 2:1 we obtained a tree which was similar to MP significantly higher than the value obtained that from analysis (Fig. 3B): {E. latimana a . . .. . . . TAN ET AL.—PARAPHYLY OF ENOPLOGNATHA OVATA GROUP 485 E. ovata XACCTGCTCAATGAAATT*TAAATAGCCGCAGTTATTTCTCTGTGCTMGGTAGCATAATCATTTGTTTrCT*AATrAA^CTAGAAT*GAAAGGTT*AAACATTTTAATT E. latlmana EE.. jaafproondiicte xXxXxXxXxXxXxXxXXXXXXXXXXXX*XXXXXXXXXXXXXXXX...X*. ATC E. margarita xxxxxxxx . * E. intrepida xxxxxxxxxxxxxxxx..*..**. ** * + atc k SStteeaattooddaa gb.. XXXX.XX.X.X*T..GTC...*..TT.AC.G*.*C..T..C..TAGCTC.AG..******....**. *...* A * T ... . E. ovata TTTTTATTTTTAAAT*AAAAATTrAAATT*ATATTAAATGTAA*AMT*ACATTrATTTTTTAAAMGACGACAAGACCCTATCGAACTTAACTTTT*GTTTAGCTGGGGCA E. latimana EEEESS....tteemaajaittaanfoorptrddgoroaaanedripiciibgt..adteaa AC*...CC..........A*A.*.C,•.CC*....AA.TT.T..CA*T***....GTCTC.TTTT.CTCTT.TC.AA*....CAA. ....AAACGAAAAA..... G T T aa *** a t' E. ovata GCTAATTAATTAA*AA*TTTTAATA**TTAATTrAT*A*ACAAA*T*GATCC*AATAAAATT*GATTAATT*AATCAAGTTACCGTAGGGATAACAGCGTAATAiTCTTTAA E. latimana EEE... mjaaafrprgooandriiicttaea ....A..GT... .A*.ATT TTT A.*..*..*..,....T..G ** . TTr *** a '-tT-tr ESS.tteeaaittnootddraaepibg..da ....AA.T ..A.**T.C T..T*ATT**G...CTT.TC.A*..A....*TTCACTA*...T**T.*.*.C.T.....AAA.A*.. .C*G*..,,,...C.TCCCAA.ACT.AC*C.A....T....*.GG*...** rT Tr E. ovata AAGC*TCTrATTTAAAAGAAAATTTGCGACCTCGATG'ITGAATTAATTTT*CCTATC*TAAT******GCAATAATTAG*AAAAGXXXXXXXXXXX E. latimana E. afrodite ...A* CXXXXXXXXXXXXXXXXXXXX]s\fAVAYAVAWA'i^\A"AVAlAfAVAYaYAVAYAVAVAWAW EEE... mjiaanrptgoraneirpciiatdaa ..*...*.TC ir.f1p•... v_,yAyAyAvAyAyAyA'^\AAAAAiC.*X.XVGXYXXXYXXXYXXYXXYXXYXXVXXYXXWXX SStteeaattooddaa gb.. TT.....*......AG...TA.GGGA. T******C*AAT *X...C*AATT*T*......G^GpTiTAVAAAGaTWACATVAGWAATAWCA — Figure 2. Comparisonofmitochondrial 16S ribosomalDNA sequences fromsix speciesofEnoplogna- tha, and Steatoda bipunctata and S. grossa. Terminology as in Figure 1. A. B. — Figure 3. Phylogeny of representatives of the genus Enoplognatha based on Maximum Likelihood using: (A.) 18S sequences. All branches are significant based on the approximation of the Likelihood Ratio Test (LRT, indicated by * in PHYLIP, Felsenstein 1993). Parsimony analysis gave three trees with similartopologies, but with less resolution in theconsensus: branches thatwerenotsupportedbybootstrap values > 50% are indicated as dashed lines; for branches that were supported, bootstrap values are given above nodes. Tree length 65, Cl 0.923. (B.) 16S sequences. All branches are significant (approximate LRT, Felsenstein 1993). Parsimony analysis gave a singletree with similartopology (seetext). Tree length 230, Cl 0.798. The off-center positions ofE. thoracica and E. intrepida indicate only 18S and only 16S sequence data obtained respectively for these two species. 486 THE JOURNAL OF ARACHNOLOGY - E.intrepida DISCUSSION - E.japonica The species E. latimana, E. penelope, E. af- _ E.afrodite rodite, and E. margarita are similar in gross ~ E.margarita morphology to the well-studied E. ovata, and 83% 100% -E.thoracica this similarity appears to be the basis for grouping these species into what has been 100%' E.latimana c&onsOikdsearlead t1o98b3e).a Tmohneopphhyylleotgiecnectliacdean(aHliypspias E.ovata presented here based on both the 16S and 18S Steatodagrossa sequences does not support monophyly ofthe Steatodabipunctata ovata group” as described by Hippa & — Oksala (1983). genFuisgurEeno4p.logPnhaytlhoagebnayseodf roenprMesaexntiamtiuvmes Loifketlhie- The E. latimana + E. ovata clade is strong- hood using the combined data set of 16S and 18S ly supported, and is consistent with evidence sequences. All branches are significant (approxi- from color polymorphism: E. ovata and E, la- mate LRT, Felsenstein 1993). Parsimony analysis timana share color, regulatory, andblack spot- gave a similar topology but with less resolution: ting polymorphisms (Oxford 1992), although branches that werenot supportedby MaximumPar- the latter species lacks the ovata color morph. simony are indicated as dashed lines; for branches These genetic traits suggest a recent common that were supported, bootstrap values are given ancestor for this species pair. Color polymor- above nodes. phism has never been reported in any other species in the ovata group”. However, the + E. ovata) and {E.japonica, E. intrepida and 18S and 16S data sets individually and com- bined consistently place E. afrodite and E. E. afrodite) formed discrete clades. The pri- margarita outside the E, latimana + E. ovata mary difference between the analyses was that clade, more closely associated with E. japon- E. margarita was placed with {E.japonica, E. ML ica and E. intrepida, and E. thoracica respec- winittrhep{iE.dalaatnidmEa.naaf+rodE.iteo)vaotna)thoen the MtrPee,trbeuet. tively. We have no molecular sequence data from E. penelope, and therefore cannot eval- Constraining E. ovata, E. latimana, E. mar- garita and E. afrodite to be monophyletic in- uate its position relative to others in the “F". MP ovata group”. creased the length of the tree by six steps The results do not refute the Mediterranean and resulted in a significantly lower log like- & ML centeroforigin hypothesis ofOxford Reillo lihood value for the tree (—1491.8 for the best tree, -1518.1 for the constrained tree). (1994), although the lack ofmonophyly ofthe Because the results from the two data sets group indicated by the current results de- mands a considerably larger representation were largely in agreement the data sets were combined and analyzedtogether. Theresulting fromthe genus be surveyed before theirorigin ML tree differed from the MP tree only in the can be identified with any degree ofcertainty. degree ofresolution it provided (Fig. 4). In all ACKNOWLEDGMENTS analyses E. ovata fell with E. latimana, E. in- trepida with E. japonica (and in most cases The work reported here was supported in with E. afrodite), E. margarita with E. thor- Hawaii by National Science Foundation Grant acica, The E. ovata + E. latimana clade fell DEB 9207753 to R.G.G. and G.S.O., and in outside all others. We concluded thatE, ovata, York by Natural EnvironmentResearch Coun- E. latimana, E. margarita and E. afrodite are cil Grant GR9/1503 to G.S.O. For allowing not monophyletic, and again tested the ro- destructive use of certain specimens, we bustness ofthese conclusions. Constraining E. would like to thank Jonathan Coddington and ovata, E. latimana, E. margarita and E. af- Scott Larcher (Smithsonian), Charles Gris- rodite to be monophyletic increased the length wold (California Academy), Herb Levi (MCZ, of the MP tree by three steps and gave a sig- Harvard) and Norman Platnick (American nificantly lower log likelihood value for the Museum of Natural History). We thank M. ML tree (—3244.9 for the best tree, —3290.5 Matsuda, J. Murphy, and the late C.J. Smith for the constrained tree). for providing us with specimens. TAN ET AL.—PARAPHYLY OF ENOPLOGNATHA OVATA GROUP 487 LITERATURE CITED tein Metabolism. (H.N. Munro, ed.). Academic Clary, D.O. &DD.NRA. Wolstenholme. 1985. The mi- KisPhriensos,, HN.ew&YMo.rk.Hasegawa. 1989. Evaluation of tochondrial molecule ofDrosophila yaku- the maximum likelihood estimate of the evolu- ba: Nucleotide sequence, gene organization and tionary treetopologies fromDNA sequencedata, genetic code. J. Mol. EvoL, 22:252-271. Felsenstein, J. 1981. Evolutionary trees fromDNA EavnodLt,he29b:r1a7n0c-h1i7n9g.order in Hominoidea. J. Mol. sequences: a maximum likelihood approach. J. Kjer, K.M., G.D. Baldridge & A.M. Fallon. 1994. Mol. EvoL, 17:368-376. Mosquito large subunit ribosomal RNA: Simul- Felsenstein, J. 1985. Confidence limits on phylog- taneous alignment of primary and secondary enies: An approach using the bootstrap. Evolu- structure. Biochim. Biophys. Acta, 1217:147- tion, 39:783-791. 155. Felsenstein, J. 1988. Phytogenies from molecular Levi, H.W. 1962. The spider genera Steatoda and sequences: Inference and reliability. Ann. Rev. Enoplognatha in America (Araneae, Theridi- Gem, 22:521-565. idae). Psyche, 69:11-36. Felsenstein, J. 1993. PHYLIP. Phylogenetic Infer- Levy, G. & P. Amitai. 1981. The spider genus En- encence Package. Version 3.5c. University of oplognatha (Araneae: Theridiidae) in Israel. Washington, Seattle. Zool. J. Linn. Soc., 72:43-67. Gilbert, D.G. 1996. SeqPup, version 0.6., Biology Locket, G.H. & A.F. Millidge. 1951. British Spi- Dept., Indiana University, Bloomington, Indiana ders, Vol. 1. Ray Soc., London. 47405. & Medrano, J.F., E. Aasen & L. Sharrow. 1990. DNA Gyllensten, V. HD.NEArlich. 1988. Generation of extraction from nucleated red blood cells. Bio- single-stranded by the polymerase chain techniques, 8:43. reaction and its applications to direct sequencing Oxford, G.S. 1976. The colour polymorphism in oUfSAt,he8H5:L7A652D-Q76a56l.ocus. Proc. Nat. Acad. Sci. Enoplo—gnatha ovatum (Clerck) (Araneae: Theri- diidae) temporal stability and spatial variabili- Haldane, J.B.S. 1939. The theory ofthe evolution ty. Heredity, 36:369-381. of dominance. J. Genet., 37:365-374. Oxford, G.S. 1983. Genetics ofcolour and its reg- Hendriks, L., C. Van Broeckhoven, A. Vandenber- ulation during development in the spider Eno- ghe, Y. Van De Peer & R. De Wachter. 1988. plognatha ovatum (Clerck) (Araneae: Theridi- Primary and secondary structure of the 18S ri- idae). Heredity, 51:621-634. bosomal RNA ofthe bird spider Eurypelma cal- Oxford, G.S. 1985. Geographical distribution of ifornica and evolutionary relationships among phenotypes regulating pigmentation in the spider eukaryotic phyla. European J. Biochem., 177: Enoplognatha ovata (Clerck) (Araneae: Theridi- 15-20. idae). Heredity, 55:37-45. Higgins, D.G., & P.M. Sharp. 1988. CLUSTAL: A Oxford, G.S. 1989. Genetics and distribution of package for performing multiple sequence align- black spotting in Enoplognatha ovata (Araneae: ment on a microcomputer. Gene, 73:237-244. Theridiidae), and the role of intermittent drift in Hillis, D.M. & M.T. Dixon. 1991. Ribosomal populationdifferentiation. Biol. J. Linn. Soc., 36: DNA: Molecular evolution and phylogenetic in- 111-128. ference. Quart. Rev. Biol., 66:411-453. Oxford, G.S. 1991. Visible morph-frequency var- & Hippa, H. I. Oksala. 1979. Colour polymor- iation in allopatric and sympatric populations of phism ofEnoplognatha ovata (Clerck) (Araneae, two species of Enoplognatha (Araneae: Theri- Theridiidae) in western Europe. Hereditas, 90: diidae). Heredity, 67:317-324. 203-212. Oxford, G.S. 1992. Enoplognatha ovata andE. la- Hippa, H. & I. Oksala. 1981. Polymorphism and timana: a comparison of their phenologies and reproductive strategies of Enoplognatha ovata genetics inNorfolkpopulations. Bull. BritishAr- (Clerck) (Araneae, Theridiidae) in northern Eu- achnol. Soc., 9:13-18. rope. Ann. Zool. Fennici, 18:179-190. Oxford, G.S. & P.R. Reillo. 1993. Trans-continen- & Hippa, H. I. Oksala. 1982. Definition and revi- tal visible morph-frequency variation at homol- sion of the Enoplognatha ovata (Clerck) group ogous loci in two species of spider, Enoplogna- (Araneae: Theridiidae). Entomol. Scandinavica, tha ovata s.s. & E. latimana. Biol. J. Linn. Soc., 13:213-222. 50:235-253. Hippa, H. & I. Oksala. 1983. Cladogenesis of the Oxford, G.S. & RR. Reillo. 1994. The world dis- Enoplognatha ovata group (Araneae, Theridi- tributions of species within the Enoplognatha idae), with description of a new Mediterranean ovata group (Araneae: Theridiidae): Implications species. Ann. Ent. Fennici, 49:71-74. for their evolution and for previous research. & Jukes, T.H. C.R. Cantor. 1969. Evolutionofpro- Bull. British Arachnol. Soc., 9:226-232. tein molecules. Pp. 21-132, In Mammalian Pro- Reillo, P.R. & D.H. Wise. 1988a. An experimental 488 THE JOURNAL OF ARACHNOLOGY evaluation of selection on color morphs of the Sanger, F., S. Nicklen & A.R. Coulsen. 1977. DNA polymorphic spider Enoplognatha ovata (Ara= sequencing with chain-terminating inhibitors. neae: Theridiidae). Evolution, 42:1172-1189, Proc. Natl. Acad. Sci. USA, 74:5463-5467. Reillo, RR. & D.H. Wise. 1988b. Genetics ofcolor Swofford, D.L. 1993. PAUP: Phylogeneticanalysis expression in the spider Enoplognatha ovata using parsimony, version 3.1.1. Smithsonian In- (Araneae: Theridiidae) from coastal Maine. stitution, Washington, DC. American Midi, Nat., 119:318-326. Tan, A.-M. & C. Onego. 1992. DNAamplification Saiki, R.K., S, Scharf, F. Faloona, K.B. Mullis, G.T from museum collections of extracts originally Horn, H.A. Erlich & N. Amheim. 1985. Enzy= intendedforallozymeanalysis. Mol. EcoL, 1:95- 97. matic amplification of B-globingenomic se- quences andrestriction siteanalysis fordiagnosis Manuscript received 10 February 1996, revised 1 of sickle cell anemia. Science, 230:1350-1354. October 1998.

See more

The list of books you might like