Logout succeed
Logout succeed. See you again!

Mycobacterium abscessus multispacer sequence typing. PDF
Preview Mycobacterium abscessus multispacer sequence typing.
Sassietal.BMCMicrobiology2013,13:3 http://www.biomedcentral.com/1471-2180/13/3 RESEARCH ARTICLE Open Access Mycobacterium abscessus multispacer sequence typing Mohamed Sassi1, Imen Ben Kahla2 and Michel Drancourt1* Abstract Background: Mycobacterium abscessus group includes antibiotic-resistant, opportunistic mycobacteria thatare responsible for sporadic cases and outbreaks of cutaneous, pulmonary and disseminated infections. However, because of their closegenetic relationships, accuratediscriminationbetween thevarious strains of these mycobacteria remains difficult.Inthis report, we describe the development ofa multispacer sequence typing (MST) analysis for the simultaneous identification and typing of M. abscessus mycobacteria. We also compared MSTwith thereference multilocus sequence analysis (MLSA) typing method. Results: Based onthe M.abscessusCIP104536T genome, eight intergenic spacers were selected, PCRamplified and sequenced in21M.abscessus isolates and analysed in48 available M. abscessus genomes. MST and MLSA grouped 37M.abscessusorganismsinto 12 and nine types, respectively; four formerly “M. bolletii”organismsand M. abscessus M139into three and four types, respectively;and 27 formerly “M.massiliense”organisms grouped into nine and five types, respectively.The Hunter-Gaston indexwas off0.912for MST and of0.903for MLSA. The MST-derived tree was similar to that based on MLSA and rpoB gene sequencing and yielded threemain clusterscomprising each the typestrain of therespective M. abscessus sub-species. Twoisolatesexhibited discordant MLSA- and rpoB gene sequence-derived position, one isolateexhibited discordant MST- and rpoBgene sequence-derived position and one isolate exhibited discordant MST- and MLSA-derivedposition. MST spacer n°2 sequencing alone allowed for the accurate identification of the different isolates atthe sub-species level. Conclusions: MSTisanewsequencing-basedapproachforbothidentifyingandgenotypingM.abscessusmycobacteria thatclearlydifferentiatesformerly“M.massiliense”organismsfromotherM.abscessussubsp.bolletiiorganisms. Keywords:Mycobacterium,Mycobacteriumabscessus,Mycobacteriummassiliense,Mycobacteriumbolletii,Multispacer sequencetyping,Genotyping Background isolated from tap water [16]. Moreover, M. abscessus Mycobacterium abscessus mycobacteria are increasingly mycobacteria have been shown to be resistant to water- being cultured from respiratory tract specimens col- borne free-living amoebae [17,18]. M. abscessus infec- lected from patients with chronic pulmonary diseases, tions are also associated with treatment failure owing, including cystic fibrosis [1-9]. These mycobacteria are due to the natural broad-spectrum resistance to antibio- also responsible for skin and soft-tissue infections tics in addition to acquired resistance, with subtle differ- following surgical and cosmetic practices [10-12] and ences in the antibiotic susceptibility pattern being catheter-related bacteremia [13,14]. These infections are observedamongisolates[19]. particularly critical for immune-compromised patients Indeed, M. abscessus is comprised of a heterogeneous and may be fatal [15]. Water is suspected as a source group of mycobacteria currently classified into M. of infection, as M. abscessus mycobacteria have been abscessus subsp. abscessus and M. abscessus subsp. bolle- tii [20,21], with the later subspecies accommodating mycobacteria previously identified as “Mycobacterium *Correspondence:[email protected] 1UnitédeRecherchesurlesMaladiesInfectieusesetTropicalesEmergentes bolletii” or “Mycobacterium massiliense” [18,22]. How- (URMITE),UMRCNRS7278,IRD198,INSERM1095.Facultédemédecine,27, ever, these organisms are nearly indistinguishable using BoulevardJeanMoulin-Cedex5,Marseille,France phenotypic tests including the mycolic acid pattern Fulllistofauthorinformationisavailableattheendofthearticle ©2013Sassietal.;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreative CommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,and reproductioninanymedium,providedtheoriginalworkisproperlycited. Sassietal.BMCMicrobiology2013,13:3 Page2of10 http://www.biomedcentral.com/1471-2180/13/3 analysisandshare100%16SrRNAgenesequencesimilar- MSTanalysis ity [20]. They were initially differentiated on the basis of Sequences of the whole intergenic spacers were >3% rpoB gene sequence divergence and different anti- extracted from the reference M. abscessus CIP104536T microbial susceptibility patterns [23,24]. Nevertheless, (ATCC19977) genome (GenBank accession CU458896.1) confusing results based on rpoB sequencing have been using the perl script software and a total of 8 spacers reported [21], and combining sequencing of the rpoB, with a 200-700-bp sequence size were further used in hsp65 and secA genes has been advocated for the optimal analysis. For each of these 8 spacers, specific PCR pri- identificationoftheM.abscessusmycobacteria[25]. mers were designed using Primer3 software v 0.4.0 To further decrypt the diversity and genetic relation- (http://frodo.wi.mit.edu/primer3) and tested in silico for ships among M. abscessus organisms, we investigated a specificity using BLAST software (http://www.ncbi.nlm. collection of reference, sequenced genomes and clinical nih.gov). The PCR conditions were first optimized using M. abscessus isolates using multispacer sequence typing DNA extracted from the reference M. abscessus, “M. (MST),which is a sequencing-based approach previously bolletii” and “M. massiliense” isolates before analysis of used for the species identification and genotyping of DNA extracted from the 17 clinical isolates (Table 1). Mycobacteria, including Mycobacterium avium [26] and The PCR amplifications were performed in a 50 μl PCR Mycobacterium tuberculosis [27] and non-mycobacterial mixture containing 5 μl 10x buffer (Qiagen, Courtaboeuf, pathogens, such as Yersinia pestis [28], Rickettsia prowa- France),200mMeachdNTP,1.5mMMgCl ,1.25UHot- 2 zekii [29] and Bartonella quintana [30]. This approach StarTaq polymerase (Qiagen), 1 μl each primer (10 pM), was here compared with multilocus sequence analaysis 33 μl nuclease-free water and 5 μl DNA template. The which relies the sequencing of 5–8 genes (21, 25), and amplification program consisted of an initial 15 min rpoB genessequencing(23,24). denaturation step at 95°C followed by 40 cycles of 30 s at 95°C, 30 s at 60°C and 1 min at 72°C; the amplification Methods was completed by a final 5-min elongation step at 72°C. Bacterialisolates Negative controls consisting of PCR mixture without Reference M. abscessus CIP104536T, M. abscessus DNA template were included in each PCR run. The pro- DSMZ44567 (German Collection of Microorganisms ductswerevisualizedbygelelectrophoresis,purifiedusing and Cell Cultures, Braunschweig, Germany), M. absces- a MultiScreen PCR filter plate (Millipore, Molsheim, sus subsp. bolletii CIP108541T (herein referred as France) and sequenced in both directions using the “M. bolletii”) andM.abscessussubsp.bolletiiCIP108297T BigDye Terminator sequencing kit (Applied Biosystems, (hereinreferredas“M.massiliense”[23])wereusedinthis Villebon-sur-Yvette, France), as previously described [27]. study. In addition, a collection of 17M. abscessus clinical The sequences were edited using the ChromasPro soft- isolatesfrom themycobacteriareferencelaboratoryof the ware (version 1.42; Technelysium Pty Ltd), aligned using Méditerranée Infection Institute, Marseille, France were Clustal W (MEGA 5 software) and compared with the alsostudied(Table1).Allofthemycobacteriaweregrown reference M. abscessus ATCC 19977 sequences (GenBank in7H9broth(Difco,Bordeaux,France)enrichedwith10% accession CU458896.1). For MST and MLSA discrimin- OADC (oleic acid, bovine serum albumin, dextrose and ation power was calculated using the Hunter-Gaston catalase)at37°C.Asfortheidentification,DNAextraction Index[31]: and rpoB partial sequence-based identification were per- (cid:4) (cid:5) X (cid:2) (cid:3) formedusingtheprimersMYCOFandMYCOR2(Table1) DI ¼1(cid:2) 1 8 n n (cid:2)1 as previously described [24]. In addition, the rpoB gene NðN (cid:2)1Þ j¼1 j j sequence retrieved from 48M. abscessus sequenced genomes was also analysed (Additional file 1) (http:// whereDisthenumericalindexofdiscrimination,Nisthe www.ncbi.nlm.nih.gov/). total number ofisolates inthe sample population, s is the total number of different types and nj is the number of ReferenceMLSAtyping isolatesbelongingtothejthtype. Fragments from five housekeeping genes argH (arginino- succinate lyase), cya (adenylate cyclase), murC (UDP Phylogeneticanalysis N-acetylmuramate-L-Ala ligase, pta (phosphate acetyl- Phylogenetic trees were constructed based onrpoBgene, transferase)andpurH(phoshoribosylminoimiazolcarboxy- concatenated MLSA genes, concatenated spacers and lase ATPase subunit) were amplified using the sets of MST spacer n°2 sequences using the neighbor–joining primers as previously described (21). The sequences of method with Kimura’s two-parameter (K2P) distance each one of these five housekeeping genes retrieved from correction model with 1000 bootstrap replications in the 48M. abscessus sequenced genomes, were also included MEGA version 5 software package [32]. The rpoB gene intheMLSAanalysis(Additionalfile1). sequence-based tree was rooted using M. chelonae strain Sassietal.BMCMicrobiology2013,13:3 Page3of10 http://www.biomedcentral.com/1471-2180/13/3 Table1Spacerscharacteristicsusedinthisstudy Name Genomeposition* Framinggenes* PCRprimers PCRproductsize(bp) Spacer1 106145-106396 MAB_0104:enoyl-CoAhydratase/isomerise F:GGGATGCGCAGATGACGGGG 506 MAB_0105c:oxidoreductase R:GCTACCCCGAATGGGGCACG Spacer2 173727-173985 MAB_0176:antigen85-Aprecursor F:TCGAGTTTCCTCCGGGCGGT 438 MAB_0177:antigen85-A/B/Cprecursor R:AATCCAGGCAGAACGGCCGC Spacer3 422777-423027 MAB_0423c:hypotheticalprotein F:GCCATTGCTGTCCGTGCGGT 344 MAB_0424:putativeprotease R:GCCGCGAACAGGCCAAACAG Spacer4 494411-494670 MAB_0495c:hypotheticalprotein F:CGCCCTTGCGCAGGAGTGAT 528 MAB_0496c:hypotheticalprotein R:GCCTGGTTCGGACGGTGACG Spacer5 761805-762060 MAB_0761c:putative3-hydroxyacyl-CoAdehydrogenase F:ACCACATCGGCGAGCGTGTG 545 MAB_0762:hypotheticalprotein R:CCAACACCGGGTCGCGGTAC Spacer6 771170-771436 MAB_0772c:hypotheticalprotein F:CGTCGGTCTTGCCGACCGTC 600 MAB_0773:hypotheticalprotein R:GGCGCCGACGATCTAGCACC Spacer7 880381-880639 MAB_0887c:hypotheticalprotein F:CGGCAGTGCAAGGTGCGTTG 519 MAB_0888c:putativefumarylacetoacetase R:GCACCGTGTCCGGTCCTCAG Spacer8 959422-959678 MAB_0950c:putativeaminoacidpermeasefamilyprotein F:GGGGCGTATGCGCCGTTACC 474 MAB_0951:putativeaminoglycosidephosphotransferase R:CGAACGCGCTGTGATTCGGC Spacer9 1002935-1003200 MAB_0995:hypotheticalprotein F:GGCCGCGACAAGCTGATCGT 684 MAB_0997c:hypotheticalprotein R:ATGCAGGGCACCGTGCGTAG Spacer10 1216613-1216879 MAB_1201c:transcriptionelongationfactorGreA F:CGTTCTCGCGCAGGTCTCCC 517 MAB_1202c:hypotheticalprotein R:CCGAACGATCCGTGCCGGTC Spacer11 1818877-1819188 MAB_1818:hypotheticalprotein F:AGCCAACTGCCATGGCGCTT 495 MAB_1819c:hypotheticalprotein R:ACCGAGACGTCATGCACCGC *WithreferencetoM.abscessusATCC19977genome. CIP 104535Tand M. immunogenum strain CIP 106684T partial rpoB gene sequence. A total of 26M. abscessus rpoB gene sequences. A heatmap was constructed using and “M. massiliense” sequenced genomes shared 99% to the R statistical software based on the spacer profile as a 100% similarity with “M. massiliense” partial rpoB gene distance matrix. sequence. The tree built from 69 partial rpoB gene sequences showed three distinct groups, each compris- ingthetype strain(Figure 1a). Results and discussion rpoBidentificationandrpoBtree The identification of M. abscessus CIP104536T, M. ReferenceMLSAanalysis abscessus DSMZ44567, M. bolletii CIP108541T and M. Fragments for the expected size were amplified and massiliense CIP108297T was confirmed by partial rpoB sequenced for the five MLSA genes. The sequences were sequencing. The sequences were deposited in the deposited in the GenBank database (GenBank accession: GenBank database (GenBank accession: KC352778 - KC352742 - KC352759, KC352760 - KC352777, KC352795). Isolates P1, P2.1, P2.2, P2.3, P2.4, P2.5, P3.1, KC352796 - KC352813, KC352814 - KC352831, P3.2, P4,P5, P6,P7 and P8exhibited 99% rpoBsequence KC352832 - KC352849). Concatenation of the five similarity with M. abscessus ATCC19977T and were sequences yielded a total of 19 different types, including identified as M. abscessus. Isolates P9 and P10 exhibited 9 types for 37M. abscessus organisms, four types for 4 99% rpoB sequence similarity with “M. bolletii” “M. bolletii” organisms and M. abscessus M139 and five CIP108541Tand were identified as “M. bolletii” whereas types for 27 “M. massiliense” organisms. The Hunter- isolate P11 exhibited 99% rpoB sequence similarity with Gaston Index for MLSA was of 0.903. The MLSA tree “M. massiliense” CIP108297T and was identified as “M. based on the five gene concatened sequences showed massiliense”. A total of 23M. abscessus sequenced gen- three principal clusters, i.e. a M. abscessus cluster, omes were identified as M. abscessus since they exhib- a “M. bolletii” cluster and a “M. massiliense” cluster ited 98 to 100% similarity with the M. abscessus type (Figure 1b). Latter cluster comprised of five sub-clusters strain rpoB partial gene sequence. M. abscessus M24 with “M. massiliense” type strain and P11 strain sub- shared 99% similarity with the M. bolletii type strain clustering together close to M. abscessus 5S strain. Also, Sassietal.BMCMicrobiology2013,13:3 Page4of10 http://www.biomedcentral.com/1471-2180/13/3 a b c Figure1PhylogenetictreebasedonrpoBgenesequence(a);basedontheconcatenatedfiveMLSAgenesequences(b);andbasedon theconcatenatedeightpolymorphicspacers(c). MLSA-derived tree clustered M. abscessus M139 strain n°2 and n°5). In “M. bolletii” isolates, the spacer sequence and P5 strain respectively identified as “M. massiliense”, polymorphisms were generated by one SNP for spacer close to the “M. bolletii” whereas both strains clus- n°1, two SNPs and one deletion for spacer n°2, two SNPs tered with M. abscessus in the rpoB gene sequence- for spacer n°3 and nine SNPs for spacer n°7. In “M. mas- derived tree. siliense” isolates, including 28 sequenced genomes, the spacer sequence polymorphism were generated by nine MSTanalysis SNPsandoneinsertion(spacern°1),oneinsertion(spacer Analysis of the reference M. abscessus ATCC 19977 n°3), five SNPs and two insertions (spacer n°4), one SNP complete genome sequence yielded 3538 intergenic (spacer n°5) and two SNPs (spacer n°7). Concatenation of spacers with>300 spacers were 200–700 bp in length. the eight spacer sequences yielded a total of 24 types, Successful PCR sequencing was achieved for 8 spacers in with the 37M. abscessus organisms grouped into 12 spa- all the isolates studied; the sequences were deposited in cer types, four formerly “M. bolletii” organisms grouped the GenBank database (GenBank accession: KC352850 - into three spacer types and 28 formerly “M. massiliense” KC352890). In M. abscessus isolates, including the 37 organisms grouped into nine spacer types. This yielded a sequenced genomes, the spacer sequence variability was Hunger-Gaston Index of 0.912. Spacer n°5 was found to generated by one to 12 single nucleotide polymorphisms be the most variable of the eight spacers under study, (SNPs) (spacers n°1 and n°8), one to 18 SNPs and one to exhibiting 13 different alleles (Table 2). When combining two nucleotide deletions (spacer n°2), one to two SNPs theeightspacersequences,auniqueMSTprofileforeach (spacers n°3 and n°7) and nucleotide insertion (spacers reference isolate was obtained, i.e., MST1 and MST2 for Sassietal.BMCMicrobiology2013,13:3 Page5of10 http://www.biomedcentral.com/1471-2180/13/3 Table2SpacersallelicpolymorphismandMSTagenotypesofM.abscessus,“M.bolletii”and“M.massiliense”isolates Isolates Spacer1 Spacer2 Spacer3 Spacer4 Spacer5 Spacer6 Spacer7 Spacer8 Genotype M.abscessus_ATCC19977_CIP104536T 1 1 1 1 1 1 1 1 1 M.abscessus_DSMZ44567 2 1 2 2 2 1 2 1 2 P1 2 1 2 2 2 1 2 1 2 P2.1 1 2 1 3 1 1 2 2 3 P2.2 1 2 1 3 1 1 2 2 3 P2.3 1 1 1 1 1 1 1 1 1 P2.4 1 1 1 1 1 1 1 1 1 P2.5 1 1 1 1 1 1 1 1 1 P2.6 1 1 1 1 1 1 1 1 1 P3.1 3 1 2 1 1 1 2 1 4 P3.2 3 1 2 1 1 1 2 1 4 P4 1 1 1 1 1 1 1 2 5 P5 1 1 1 1 3 1 2 1 6 P6 1 1 1 1 1 1 1 1 1 P7 4 1 2 4 4 1 2 1 7 P8 4 1 2 4 4 1 3 1 8 M.abscessus_3A-0930-R_3A_0930_R 1 1 1 1 1 1 1 1 1 M.abscessus_3A-0930-S_3A_0930_S 1 1 1 1 1 1 1 1 1 M.abscessus_3A-0122-S_3A_0122_S 1 1 1 1 1 1 1 1 1 M.abscessus_3A-0731_3A_0731 1 1 1 1 1 1 1 1 1 M.abscessus_3A-0122-R_3A_0122_R 1 1 1 1 1 1 1 1 1 M.abscessus_3A-0119-R_3A_0119_R 1 1 1 1 1 1 1 1 1 M.abscessus_6G-0728-R_M6G_0728_R 1 1 1 1 1 1 1 1 1 M.abscessus_6G-0212_M6G_0212 1 1 1 1 1 1 1 1 1 M.abscessus_6G-1108_6G_1108 1 1 1 1 1 1 1 1 1 M.abscessus_6G-0728-S_6G_0728_S 1 1 1 1 1 1 1 1 1 M.abscessus_6G-0125-R_6G_0125_R 1 1 1 1 1 1 1 1 1 M.abscessus_6G-0125-S_6G_0125_S 1 1 1 1 1 1 1 1 1 M.abscessus_4S-0116-S_4S_0116_S 5 1 2 5 5 2 2 2 9 M.abscessus_4S-0116-R_4S_0116_R 5 1 2 5 5 2 2 2 9 M.abscessus_4S-0206_M4S_0206 5 1 2 5 5 2 2 2 9 M.abscessus_4S-0726-RB_4S_0726_RB 5 1 2 5 5 2 2 2 9 M.abscessus_4S-0303_4S_0303 5 1 2 5 5 2 2 2 9 M.abscessus_4S-0726-RA_4S_0726_RA 5 1 2 5 5 2 2 2 9 M.abscessus_M93 3 1 2 6 6 1 2 3 10 M.abscessus_M94 2 1 2 2 7 1 4 2 11 M.abscessus_M152 2 1 2 7 7 1 2 3 12 M.bolletti_CIP108541T 6 3 3 3 8 1 5 2 13 P9 6 3 3 3 8 1 5 2 13 P10 7 4 1 3 8 1 2 2 14 M.abscessus_M24 8 3 4 8 8 1 2 2 15 M.massilliense_CIP108297T 5 5 5 9 9 1 6 3 16 P11 5 5 5 9 9 1 6 3 16 M.massiliense_2B-0912-S_2B_0912_S 9 5 6 10 10 2 7 3 17 M.massiliense_2B-030_M2B_0307 9 5 6 10 10 2 7 3 17 M.massiliense_2B-0912-R_2B_0912_R 9 5 6 10 10 2 7 3 17 M.massiliense_2B-0626_M2B_0626 9 5 6 10 10 2 7 3 17 Sassietal.BMCMicrobiology2013,13:3 Page6of10 http://www.biomedcentral.com/1471-2180/13/3 Table2SpacersallelicpolymorphismandMSTagenotypesofM.abscessus,“M.bolletii”and“M.massiliense”isolates (Continued) M.massiliense_2B-1231_M2B_1231 9 5 6 10 10 2 7 3 17 M.massiliense_2B-0107_M2B_0107 9 5 6 10 10 2 7 3 17 M.massiliense_1S-154-0310_M1S_154_0310 9 5 6 10 10 2 7 3 17 M.massiliense_1S-152-0914_M1S_152_0914 9 5 6 10 10 2 7 3 17 M.massiliense_1S-153-0915_M1S_153_0915 9 5 6 10 10 2 7 3 17 M.massiliense_1S-151-0930_M1S_151_0930 9 5 6 10 10 2 7 3 17 M.massiliense_M18 9 5 6 10 10 2 7 3 17 M.abscessus_M159 9 6 6 9 10 3 7 4 18 M.abscessus_47J26 9 5 6 6 11 4 7 3 19 M.abscessus_M172 10 7 2 9 12 3 8 5 20 M.abscessus_M154 10 7 2 9 12 3 8 5 20 M.abscessus_5S-1215_5S_1215 11 5 2 6 13 2 6 2 21 M.abscessus_5S-1212_5S_1212 11 5 2 6 13 2 6 2 21 M.abscessus_5S-0817_5S_0817 11 5 2 6 13 2 6 2 21 M.abscessus_5S-0708_5S_0708 11 5 2 6 13 2 6 2 21 M.abscessus_5S-0422_5S_0422 11 5 2 6 13 2 6 2 21 M.abscessus_5S-0304_5S_0304 11 5 2 6 13 2 6 2 21 M.abscessus_5S-0421_5S_0421 11 5 2 6 13 2 6 2 21 M.abscessus_M156 10 7 2 11 12 3 9 5 22 M.abscessus_M148 10 7 2 11 12 3 9 5 23 M.abscessus_M139 10 5 2 11 14 3 10 3 24 DI 0.8295 0.6228 0.6969 0.8001 0.8371 0.6038 0.8084 0.7158 0.912 aMST=MultispacerSequenceTyping.bisolateswerelistedwithreferencetotheircorrespondingpatient,forexampleP1=isolate1frompatient1,P2.1=isolate 1frompatient2,etc.cDI=Discriminationindex. M. abscessus CIP104536T and M. abscessus DSMZ44567 sameMSTprofile(MST17).M.abscessus5Sisolateexhib- respectively, MST13 for “M. bolletii” CIP108541T and itedtheMST21profile. MST16for“M.massiliense”CIP108297T.Atthesequence level, wefound thatMST1and MST2genotypes differ by MSTbasedtreeandcomparaisonwithrpoBidentification at most nine SNPs, whereas MST1 differed from MST13 andMLSAanalysis by up to 18 SNPs, one insertion and two deletions and The MST-phylogenetic tree clustered isolates from fromMST16by14SNPs, 11deletionsandtwo insertions patients P1 to P8 with M. abscessus reference strain, iso- (supplementary material). The 17 clinical M. abscessus lates from P9 and P10 with “M. bolletii” and isolate from isolates were grouped into eight MST types, named P11 with “M. massiliense”, in agreement with their rpoB MST1 to MST8, with five M. abscessus isolates exhib- sequence-based identification and MLSA analysis iting the M. abscessus CIP104536T MST1 genotype and (Figure 1c). The MST, MLSA and rpoB phylogenetic one isolate (P1 strain) exhibiting the M. abscessus trees separated the M. abscessus isolates into three prin- DSMZ44567MST2genotype.TheP9“M.bolletii”clinical cipal clusters depicted by M. abscessus, “M. bolletii” and isolate yielded the MST13 genotype in common with the “M. massiliense” isolates (Figure 1a, b and c). However, reference “M. bolletii” CIP108541T, whereas the P10 “M. MST resolved “M. bolletii” cluster into two sub-clusters bolletii” clinical isolate yielded a unique MST14 genotype formed by isolate P5 and all of the other M. bolletii iso- that differ from MST13 by two SNPs in spacer n°1. M. lates with a 76% bootstrap value, wich is discordant with abscessus M24 yielded the MST15 and differed from MLSA and rpoB based tree. Each cluster or sub-cluster MST13 by four polymorphic spacers. In “M. massiliense” of the M. abscessus isolates corresponded to different nine different profiles weregenerated MST 16 toMST24. genotypes. The “M. massiliense” cluster was more dis- The P11 “M. massiliense” clinical isolate shared the perse and divided into six sub-clusters with isolate P11 MST16 genotype with the reference “M. massiliense” and “M. massiliense” type strain sub-clustering alone. CIP108297T. “M. massiliense” 2B isolate, “M. massiliense” The results of this analysis were consistent for 67 iso- 1S isolate and “M. massiliense” M18 isolate shared the lates and inconsistent for two isolates P5 and M. Sassietal.BMCMicrobiology2013,13:3 Page7of10 http://www.biomedcentral.com/1471-2180/13/3 Color Key and Histogram 0 5 nt2 u o C00 1 0 2 4 6 8 12 Value M.massiliense_2B−030_M2B_0307 M.massiliense_2B−0912−S_2B_0912_S M.massiliense_2B−0912−R_2B_0912_R M.massiliense_2B−0626_M2B_0626 M.massiliense_2B−1231_M2B_1231 M.massiliense_2B−0107_M2B_0107 M.massiliense_1S−154−0310_M1S_154_0310 M.massiliense_1S−152−0914_M1S_152_0914 M.massiliense_1S−153−0915_M1S_153_0915 M.massiliense_1S−151−0930_M1S_151_0930 M.massiliense_M18 M.abscessus_M159 M.abscessus_47J26 M.abscessus_5S−1212_5S_1212 M.abscessus_5S−1215_5S_1215 M.abscessus_5S−0817_5S_0817 M.abscessus_5S−0708_5S_0708 M.abscessus_5S−0422_5S_0422 M.abscessus_5S−0304_5S_0304 M.abscessus_5S−0421_5S_0421 M.abscessus_M148 M.abscessus_M156 M.abscessus_M154 M.abscessus_M172 M.abscessus_M139 M.abscessus_4S−0116−R_4S_0116_R M.abscessus_4S−0116−S_4S_0116_S M.abscessus_4S−0206_M4S_0206 M.abscessus_4S−0726−RB_4S_0726_RB M.abscessus_4S−0303_4S_0303 s PM8.abscessus_4S−0726−RA_4S_0726_RAe MP7.abscessus_M152 at M.abscessus_M93 PM9.abscessus_M94 ol M.bolletti_CIP108541T s PP1110 i M.massilliense_CIP108297T M.abscessus_M24 P2.3 M.abscessus_ATCC19977_CIP104536T P2.4 P2.5 P2.6 P6 M.abscessus_3A−0930−R_3A_0930_R M.abscessus_3A−0930−S_3A_0930_S M.abscessus_3A−0122−S_3A_0122_S M.abscessus_3A−0731_3A_0731 M.abscessus_3A−0122−R_3A_0122_R M.abscessus_3A−0119−R_3A_0119_R M.abscessus_6G−0728−R_M6G_0728_R M.abscessus_6G−0212_M6G_0212 M.abscessus_6G−1108_6G_1108 M.abscessus_6G−0728−S_6G_0728_S M.abscessus_6G−0125−R_6G_0125_R M.abscessus_6G−0125−S_6G_0125_S P4 P5 P1 M.abscessus_DSMZ44567 P3.2 P3.1 P2.2 P2.1 3 6 8 2 7 4 1 5 r r r r r r r r e e e e e e e e c c c c c c c c a a a a a a a a p p p p p p p p s s s s s s s s spacers Figure2HeatmapandclusteringofM.abscessusmycobacteriaunderstudybasedindifferenceofprofile. abscessus M139. A heatmap incorporating all spacer pat- previous taxonomy proposal and are now grouped as terns into a matrix further demonstrated that spacer n°2 M. abscessus subsp. bolletii according to a recent was the most discriminating spacer (Figure 2). Hence, taxonomyproposal[20,21]. the tree based on the spacer n°2 sequence also discrimi- nated the three M. abscessus, “M. bolletii” and “M. mas- Conclusion siliense” clusters (Figure 3). Thisdiscrimination potential Wehereindevelopedasequencing-basedMSTgenotyping makes spacer n°2 a useful new tool for the accurate technique that allows the accurate identification and identification of M. abscessus subspecies. Furthermore, discrimination of M. abscessus mycobacteria. Therefore, these data indicated that it was readily possible to dis- MSTcould be added to the panel of molecular methods criminate isolates that would have been identified as currently available for genotyping M. abscessus mycobac- “M. bolletii” [26] or “M. massiliense” [23] using a teria, with the advantages that MST is a PCR and Sassietal.BMCMicrobiology2013,13:3 Page8of10 http://www.biomedcentral.com/1471-2180/13/3 Figure3PhylogenetictreebasedonMSTspacern°2sequence. Sassietal.BMCMicrobiology2013,13:3 Page9of10 http://www.biomedcentral.com/1471-2180/13/3 sequencing-based technique, thereby providing a robust References andaccurateresultwithoutrequiringahighDNAconcen- 1. GriffithDE,GirardWM,WallaceRJJr:Clinicalfeaturesofpulmonary diseasecausedbyrapidlygrowingmycobacteria.Ananalysisof154 tration and purity, as is the case for pulsed-field gel patients.AmRevRespirDis1993,147:1271–1278. electrophoresis (PFGE) [5] and randomly amplified poly- 2. Pierre-AudigierC,FerroniA,Sermet-GaudelusI,LeBourgeoisM,OffredoC, morphic DNA (RAPD) [33]. Furthermore, MST targets Vu-ThienH,FaurouxB,MarianiP,MunckA,BingenE,GuillemotD,Quesne G,VincentV,BercheP,GaillardJL:Age-relatedprevalenceanddistribution intergenic spacers, which undergo less evolutionary pres- ofnontuberculousmycobacterialspeciesamongpatientswithcystic sure and are thus more variable than the housekeeping fibrosis.JClinMicrobiol2005,43:3467–3470. genes targeted in multilocus sequence typing [21]. Also, 3. OlivierKN,WeberDJ,WallaceRJJr,FaizAR,LeeJH,ZhangY,Brown-ElliotBA, HandlerA,WilsonRW,SchechterMS,EdwardsLJ,ChakrabortiS,KnowlesMR,et MST incorporating sequencing is an open approach to al:Nontuberculousmycobacteria.I:multicenterprevalencestudyincystic describednewgenotypesmoreversatilethancountingthe fibrosis.AmJRespirCritCareMed2003,167:828–834. number of tandem repeats [34]. We propose that MST 4. ChalermskulratW,SoodN,NeuringerIP,HeckerTM,ChangL,RiveraMP, ParadowskiLJ,ArisRM:Non-tuberculousmycobacteriainendstagecystic could be incorporated into a polyphasic molecular fibrosis:implicationsforlungtransplantation.Thorax2006,61:507–513. approach to resolve the phylogenetic relationships of 5. JönssonBE,GilljamM,LindbladA,RidellM,WoldAE,Welinder-OlssonC: difficult-to-identify M. abscessus isolates [35]. Combining MolecularepidemiologyofMycobacteriumabscessus,withfocuson MSTdatawithphylogeneticanalysesclearlyindicatedthat cysticfibrosis.JClinMicrobiol2007,45:1497–1504. 6. LevyI,Grisaru-SoenG,Lerner-GevaL,KeremE,BlauH,BenturL,AviramM, M. abscessus heterogeneity spans beyond the current two RivlinJ,PicardE,LavyA,YahavY,RahavG:Multicentercross-sectional M. abscessus subspecies, as two “M. massiliense” isolates studyofnontuberculousmycobacterialinfectionsamongcysticfibrosis were readily discriminated from the other “M. bolletii” patients.IsraelEmergInfectDis2008,14:378–384. 7. GriffithDE:Emergenceofnontuberculousmycobacteriaaspathogensin isolates [21]. These data, therefore, question the current cysticfibrosis.AmJRespirCritCareMed2003,167:810–812. nomenclature of M. abscessus mycobacteria, which 8. RouxAL,CatherinotE,RipollF,SoismierN,MacherasE,RavillyS,BellisG,Vibet incorporates mycobacteria previously recognized as “M. MA,LeRouxE,LemonnierL,GutierrezC,VincentV,FaurouxB,RottmanM, bolletii” and “M. massiliense” as “M. abscessus subsp. GuillemotD,GaillardJL,Jean-LouisHerrmannfortheOMAGroup:Multicenter studyofprevalenceofnontuberculousmycobacteriainpatientswithcystic bolletii”. The data presented here indicate that this no- fibrosisinfrance.JClinMicrobiol2009,47:4124–4128. menclature masks the underlying diversity of M. 9. UyanZS,ErsuR,OktemS,CakirE,KoksalanOK,KaradagB,KarakocF,Dagli E:Mycobacteriumabscessusinfectioninacysticfibrosispatient:a abscessus mycobacteria, potentially hampering the difficulttotreatinfection.IntJTubercLungDis2010,14:250–251. recognition of microbiological, epidemiological and 10. FuruyaEY,PaezA,SrinivasanA,CookseyR,AugenbraunM,BaronM, clinical particularities that are linked to each subspe- BrudneyK,Della-LattaP,EstivarizC,FischerS,FloodM,KellnerP,RomanC, cies. The elevation of “M. massiliense” as a new M. YwaokurunsdMin,fWecetiisosnDs,aGmraonnogw“itlzipEoVt:oOuruistbtsr”eafrkomoftmhyecUobnaitcetderiSutmateasbwschesosus abscessus subspecies would accommodate the data underwentabdominoplastyintheDominicanRepublic.ClinInfectDis producedinthepresentstudy[24]. 2008,46:1181–1188. 11. KohSJ,SongT,KangYA,ChoiJW,ChangKJ,ChuCS,JeongJG,LeeJY, SongMK,SungHY,KangYH,YimJJ:Anoutbreakofskinandsofttissue infectioncausedbyMycobacteriumabscessusfollowingacupuncture.Clin Additional file MicrobiolInfect2010,16:895–901. 12. Viana-NieroC,LimaKV,LopesML,RabelloMC,MarsolaLR,BrilhanteVC, Additionalfile1:rpoBandMLSAgenesaccessionNumberof49 DurhamAM,LeãoSC:MolecularcharacterizationofMycobacterium sequencedgenomes. massilienseandMycobacteriumbolletiiinisolatescollectedfrom outbreaksofinfectionsafterlaparoscopicsurgeriesandcosmetic procedures.JClinMicrobiol2008,46:850–855. 13. PetriniB:Mycobacteriumabscessus:anemergingrapid-growingpotential Competinginterests pathogen.APMIS2006,114:319–328. Theauthorsdeclarethattheyhavenocompetinginterest. 14. HayesDJr:Mycobacteriumabscessusandothernontuberculous mycobacteria:evolvingrespiratorypathogensincysticfibrosis:acase Authors’contributions reportandreview.SouthernMedJ2005,98:657–661. 15. SanguinettiM,ArditoF,FiscarelliE,LaSordaM,D’argenioP,RicciottiG, MSandIBKperformedmolecularanalyses.MDdesignedthestudy.IBK,MS FaddaG:Fatalpulmonaryinfectionduetomultidrug-resistant andMDinterpreteddataandwrotethedraft.Allauthorsreadandapproved Mycobacteriumabscessusinapatientwithcysticfibrosis.JClinMicrobiol thefinalmanuscript. 2001,39:816–819. 16. ShinJH,LeeHK,ChoEJ,YuJY,KangYH:TargetingtherpoBgeneusing Acknowledgments nestedPCR-restrictionfragmentlengthpolymorphismforidentification IBKwasfinanciallysupportedbytheOeuvreAntituberculeusedesBouches ofnontuberculousmycobacteriainhospitaltapwater.JMicrobiol2008, duRhône.MSwasfinanciallysupportedbyInfectiopoleSudFoundation. 46:608–614. 17. HuangWC,ChiouCS,ChenJH,ShenGH:Molecularepidemiologyof Authordetails Mycobacteriumabscessusinfectionsinasubtropicalchronicventilatory 1UnitédeRecherchesurlesMaladiesInfectieusesetTropicalesEmergentes setting.JMedMicrobiol2010,59:1203–1211. (URMITE),UMRCNRS7278,IRD198,INSERM1095.Facultédemédecine,27, 18. AdékambiT,BenSalahI,KhlifM,RaoultD,DrancourtM:Survivalof BoulevardJeanMoulin-Cedex5,Marseille,France.2Laboratoirede environmentalmycobacteriainAcanthamoebapolyphaga.ApplEnviron Microbiologieetd’Immunologie,UR02/SP13,CHUFarhatHachedSousse, Microbiol2006,72:5974–5981. Tunisie,France. 19. KohWJ,JeonK,LeeNY,KimBJ,KookYH,LeeSH,ParkYK,KimCK,ShinSJ, HuittGA,DaleyCL,KwonOJ:Clinicalsignificanceofdifferentiationof Received:7March2012Accepted:20December2012 MycobacteriummassiliensefromMycobacteriumabscessus.AmJRespirCrit Published:7January2013 CareMed2011,183:405–410. Sassietal.BMCMicrobiology2013,13:3 Page10of10 http://www.biomedcentral.com/1471-2180/13/3 20. LeaoSC,TortoliE,Viana-NieroC,UekiSY,LimaKV,LopesML,YuberoJ, MenendezMC,GarciaMJ:Characterizationofmycobacteriafromamajor Brazilianoutbreaksuggeststhatrevisionofthetaxonomicstatusof membersoftheMycobacteriumchelonae-M.abscessusgroupisneeded. JClinMicrobiol2009,47:2691–2698. 21. MacherasE,RouxAL,BastianS,LeãoSC,PalaciM,Sivadon-TardyV,GutierrezC, RichterE,Rüsch-GerdesS,PfyfferG,BodmerT,CambauE,GaillardJL,HeymB: MultilocussequenceanalysisandrpoBsequencingofMycobacterium abscessus(sensulato)strains.JClinMicrobiol2011,49:491–499. 22. AdékambiT,Reynaud-GaubertM,GreubG,GevaudanMJ,LaScolaB,Raoult D,DrancourtM:Amoebalcocultureof“mycobacteriummassiliense”sp. nov.Fromthesputumofapatientwithhemoptoicpneumonia.JClin Microbiol2004,42:5493–5501. 23. AdékambiT,DrancourtM:Dissectionofphylogeneticrelationships among19rapidlygrowingMycobacteriumspeciesby16SrRNA,hsp65, sodA,recAandrpoBgenesequencing.IntJSystEvolMicrobiol2004, 54:2095–2105. 24. AdékambiT,BergerP,RaoultD,DrancourtM:rpoBgenesequence-based characterizationofemergingnon-tuberculousmycobacteriawith descriptionsofMycobacteriumbolletiisp.nov.,Mycobacteriumphocaicum sp.nov.andMycobacteriumaubagnensesp.nov.IntJSystEvolMicrobiol 2006,56:133–143. 25. MacherasE,RouxAL,RipollF,Sivadon-TardyV,GutierrezC,GaillardJL, HeymB:Inaccuracyofsingle-targetsequencingfordiscriminating speciesoftheMycobacteriumabscessusgroup.JClinMicrobiol2009, 47:2596–2600. 26. CayrouC,TurenneC,BehrMA,DrancourtM:Genotypingof Mycobacteriumaviumcomplexorganismsusingmultispacersequence typing.Microbiol2010,156:687–694. 27. DjelouadjiZ,ArnoldC,GharbiaS,RaoultD,DrancourtM:Multispacer sequencetypingforMycobacteriumtuberculosisgenotyping.PLoSOne 2008,3:e2433. 28. DrancourtM,RouxV,DangLV,Tran-HungL,CastexD,Chenal-FrancisqueV, OgataH,FournierPE,CrubézyE,RaoultD:Genotyping,Orientalis-like Yersiniapestis,andPlaguePandemics.EmerInfectDis2004,10:1585–1592. 29. WenjunLI,MouffokN,RoveryC,ParolaP,RaoultD:GenotypingRickettsia conoriidetectedinpatientswithMediterraneanspottedfeverinAlgeria usingmultispacertyping(MST).ClinMicrobiolInf2009,15:281–283. 30. FoucaultC,LaScolaB,LindroosH,AnderssonSGE,RaoultD:Multispacer typingtechniqueforsequence-basedtypingofBartonellaQuintana. JClinMicrobiol2005,43:41–48. 31. HunterPR,GastonMA:Numericalindexofthediscriminatoryabilityof typingsystems:anapplicationofSimpson’sindexofdiversity.JClin Microbiol1988,26:2465–2466. 32. KumarS,TamuraK,JakobsenIB,NeiM:MEGA2:molecularevolutionary geneticsanalysissoftware.Bioinformatics2001,17:1244–1245. 33. ZhangY,RajagopalanM,BrownBA,WallaceRJJr:Randomlyamplified polymorphicDNAPCRforcomparisonofMycobacteriumabscessus strainsfromnosocomialoutbreaks.JClinMicrobiol1997,35:3132–3139. 34. ChoiGE,ChulhunLC,WhangJ,KimHJ,KwonOJ,KohWJ,ShinSJ:Efficient differentiationofmycobacteriumabscessuscomplexisolatestothe specieslevelbyanovelPCR-basedvariable-numbertandem-repeat assay.JClinMicrobiol2011,49:1107–1109. 35. ZelaznyAM,RootJM,SheaYR,ColomboRE,ShamputaIC,StockF,Conlan S,McNultyS,Brown-ElliottBA,WallaceRJJr,OlivierKN,HollandSM, SampaioEP:Cohortstudyofmolecularidentificationandtypingof Mycobacteriumabscessus,Mycobacteriummassiliense,andMycobacterium bolletii.JClinMicrobiol2009,47:1985–1995. Submit your next manuscript to BioMed Central and take full advantage of: doi:10.1186/1471-2180-13-3 Citethisarticleas:Sassietal.:Mycobacteriumabscessusmultispacer sequencetyping.BMCMicrobiology201313:3. • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit