loading

Logout succeed

Logout succeed. See you again!

ebook img

Morphological and phylogenetic diversity of thermophilic cyanobacteria in Algerian hot springs PDF

pages13 Pages
release year2014
file size2.01 MB
languageEnglish

Preview Morphological and phylogenetic diversity of thermophilic cyanobacteria in Algerian hot springs

Extremophiles DOI10.1007/s00792-014-0680-7 ORIGINAL PAPER Morphological and phylogenetic diversity of thermophilic cyanobacteria in Algerian hot springs Samia Amarouche-Yala • Ali Benouadah • Abd El Ouahab Bentabet • Purificacio´n Lo´pez-Garc´ıa Received:19March2014/Accepted:13July2014 (cid:2)SpringerJapan2014 Abstract Geothermal springs in Algeria have been Synechocystis, Microcoleus, Cyanobacterium, Chroococ- known since the Roman Empire. They mainly locate in cusandGeitlerinema.Moleculardiversityanalyseswerein Eastern Algeria and are inhabited by thermophilic organ- good general agreement with classical identification and isms, which include cyanobacteria forming mats and con- allowed thedetectionofadditionalspeciesinthreesprings cretions. In this work, we have investigated the withtemperatureshigherthan50 (cid:3)C.Theycorrespondedto cyanobacterial diversity of these springs. Cyanobacteria aSynechococcuscladeandtorelativesoftheintracellularly were collected from water, concretions and mats in nine calcifying Candidatus Gloeomargarita lithophora. The hot springs with water temperatures ranging from 39 to hottest springs were dominated by members of Lep- 93 (cid:3)C. Samples were collected for isolation in culture, tolyngbya, Synechococcus-like cyanobacteria and Gloeo- microscopic morphological examination, and molecular margarita,whereasOscillatorialesotherthanLeptolyngbya, diversity analysis based on 16S rRNA gene sequences. Chroococcales and Stigonematales dominated lower tem- Nineteen different cyanobacterial morphotypes were iden- peraturesprings.Theisolationofsomeofthesestrainssets tified, the most abundant of which were three species of thegroundforfuturestudiesonthebiologyofthermophilic Leptolyngbya, accompanied by members of the genera cyanobacteria. Gloeocapsa, Gloeocapsopsis, Stigonema, Fischerella, Keywords Cyanobacteria (cid:2) Hot spring (cid:2) Thermophilic (cid:2) Microbial mat (cid:2) Biomineralization (cid:2) Carbonate CommunicatedbyA.Oren. Electronicsupplementarymaterial Theonlineversionofthis article(doi:10.1007/s00792-014-0680-7)containssupplementary Introduction material,whichisavailabletoauthorizedusers. Cyanobacteria constitute a phylum of photosynthetic bac- S.Amarouche-Yala NuclearResearchCenterofAlgiers,Bd.FrantzFanon, teriaofcrucialimportanceinecology andevolution. Their BP399Algiers-RP,16000Algiers,Algeria ancestor developed oxygenic photosynthesis, thus leading e-mail:[email protected] totheoxygenationoftheEarth’satmosphereandimposing novel environmental selective constraints to other groups S.Amarouche-Yala UniversityofAbderhamaneMira,RoutedeTargaOuzemmour, of organisms (Herrero and Flores 2008). The chloroplasts Be´jaia,Algeria of eukaryotic plants and algae derived from ancestral cyanobacterial endosymbionts, which led to another major A.Benouadah(cid:2)A.ElOuahabBentabet diversification event in the history of terrestrial life (Ne- UniversityofMohamedElBachirElIbrahimi,BordjBou, Arre´ridj,Algeria lissen et al. 1995; Cavalier-Smith 2002). From an ecolog- ical point of view, cyanobacteria are also extremely P.Lo´pez-Garc´ıa(&) successful, being able to thrive in a wide variety of eco- Unite´d’Ecologie,Syste´matiqueetEvolution,CNRSUMR8079, systems. These include not only oceans and freshwater Universite´ Paris-Sud,91405Orsay,France e-mail:[email protected] systems,butalsomanyextremeenvironments.Essentially, 123 Extremophiles except for acidic environments (pH\5), they have colo- In this work, we report the results of a study of the nized most extreme habitats, such as hypersaline settings, cyanobacterial communities innine hotsprings inAlgeria. hyperarid desert areas, UV and ionizing radiation-exposed We combined classical morphological studies done with settings and even rock interiors (Garcia-Pichel et al. 1998; microscopy examination with molecular diversity studies Wierzchos et al. 2006; Warren-Rhodes et al. 2006; Gor- based on the amplification, cloning and sequencing of 16S bushina and Broughton 2009; Ragon et al. 2011). rRNAgenesfromenrichmentculturesandnaturalsamples. Cyanobacteria are also able to live at the upper limit temperature for photosynthesis, up to 74 (cid:3)C, in thermal springs and their associated microbial mats (Castenholz Materials and methods 2001). Thermophilic cyanobacteria from the Yellowstone National Park were the first, and possibly the most exten- Sampling sites sively studied (Dyer and Gafford 1961; Castenholz 1969; Brock 1967; Ward et al. 1998). But, although cyanobac- Nine hot springs from different regions in Algeria, mainly teria from other thermal areas have also been explored to in the East of the country, were investigated (Table 1; some extent, many remain unstudied. Classical morpho- Figure S1). Sampling was carried out in May 2011. Hot logical studies reveal the conspicuous presence of some spring water was collectedinpropercontainers as close as genera in this kind of environments, such as Synechococ- possible to the spring discharge point. Standard physico- cus, Phormidium, Calothrix or Mastigocladus (Castenholz chemical parameters such as water temperature, pH, con- 2001). However, molecular phylogeny studies show that ductivity, total dissolved solids (TDS) and dissolved oxy- many cyanobacteria with relatively simple morphotypes gen were measured in the field using a WTW multi- (e.g., Synechococcus) are polyphyletic (Robertson et al. parameter probe. Water samples for metal and cation 2001). Accordingly, more recent molecular diversity concentration analysis were collected in 250-ml polyeth- exploration approaches suggest that simple morphotypes ylenebottlesafterfiltrationthrough0.45-lmpore-diameter may conceal a previously unsuspected diversity and membranesandacidified(1 %v/vHNO ).Microbialmats, 3 include some very distant lineages (Ferris et al. 1997; concretions and sediments for the study of cyanobacterial Nubeletal.1997;MillerandCastenholz2000;Norrisetal. enrichments were picked with sterile forceps and spatula 2002; Bhaya et al. 2007). Some of these lineages can and placed in sterile containers. Thermal water for indeed possess unique properties, as was recently demon- cyanobacterial cultures was collected at the sampling sites strated by the enrichment of a small, early-branching insterileglassvialsandtubes.Samplesusedformolecular cyanobacterium capable of forming intracellular Mg–Ca– analysis were collected in the same way from enrichments Sr–Ba–carbonates,whoseclosestrelativesseemtothrivein in solid culture media or natural mats, and placed on ice thermophilic microbial mats (Couradeau et al. 2012). during transportation to the laboratory for DNA The Algerian territory has about two hundred hydro- purification. thermal resources localized mainly in the alpine orogenic belt between the littoral and the Southern pediment of the Physico-chemical analysis Saharanchain.Thecurativepropertiesofspringwatersand their spatial distribution have facilitated the advent of a Springwatertemperature,pH,conductivity,totaldissolved long-term resort tradition with recognized effects in care solids,dissolvedoxygenandtotalalkalinitybytitration(as and therapies. Algerian thermal springs have been studied HCO2)weremeasuredinthefieldusingaWTWprobeand mostly from the perspective of geothermal resources 3 a conductivimeter (Mettler Toledo Mate 90 England). (Kedaid 2007; Saibi 2009), hydrogeological aspects and Potassium (K?), Calcium (Ca2?), sodium (Na?), Magne- physico-chemical composition (Verdeil 1982; Dib 1985; sium (Mg2?), Lithium (Li?), nitrate (NO -), sulfate Issaadi 1992). The biological study of these ecosystems in 3 (SO 2-), chloride (Cl-), fluorine (F-) and bromine (Br-) Algeriastartedmorethan74 yearsagowiththeexpedition 4 contents were determined by ion chromatography (IC, ofaFrenchcolonialexplorerwhostudiedthefaunaofone DionexDX-120). The total silica in water was determined of the hottest springs, ‘‘Meskoutine spring’’ (Masson by a colorimetric method. The content of metals, namely, 1939). However, only a few studies on thermophilic bac- aluminum,arsenic,iron,manganeseandzincwasanalyzed teriainhabitingthesehotsprings,withtheisolationofnew using a Perkin Elmer Optima Inductively Coupled Plasma extremophile species have been conducted since then Optical Emission Spectrometer (ICP-OES, 7000 DV). The (Kecha et al. 2007; Bouanane-Darenfed et al. 2011), and analyticalerrorforICandICP-OESwasB5 %.Valuesare the cyanobacteria of Algerian hot springs have remained provided in Table 2. unexplored so far. 123 Extremophiles d e vn Dissoloxyge(mg/l) 1.5 4.7 3.3 0.2 0.5 0.4 3.3 5.0 5.0 0 2 2 6 2 0 5 5 6 TDS(g/l) 14.6 1.7 1.8 1.5 1.1 15.5 11.5 2.7 17.5 y vit ctim) nduS/c 6 41 6 03 01 4 5 5 1 Co(m 23. 3. 3. 3. 2. 24. 18. 5. 28. 2 0 0 7 7 2 9 0 5 H 4 1 7 0 2 0 6 8 4 p 6. 7. 6. 6. 6. 6. 6. 6. 6. Flowrate(l/s) 6 50 60 4 80 0.5 6 10 30 e ur at Sourcetemper(C)(cid:3) 75 50 50 39 93 54 53 70 52 eveel) dov Altitu(mabseale 554 1.118 1.075 1.075 351 556 472 161 226 NE NE NE NE NE NE NE NW NE study Coordinates 00047.683611(cid:3)00023.64423(cid:3) 000352616.95(cid:3)00009.92705(cid:3) 000352918.77(cid:3)00011.90715(cid:3) 000361355.89(cid:3)00042.38802(cid:3) 000362735.16(cid:3)00009.98716(cid:3) 000362509.84(cid:3)00017.92559(cid:3) 000362211.17(cid:3)00055.95446(cid:3) 000352157.69(cid:3)00055.36057(cid:3) 000362455.38(cid:3)00012.57436(cid:3) s inthi eridj) nde sandsamplesanalyzed Springname(region) ElBibanes(BordjBouArreridj) Essalihine(Khenchela) Knif(Khenchela) Tassa(SoukAhras) Meskoutine(Guelma) ´BeniGuechat(Mila) ¨Ibaınen(BordjBouArr Bouhadjar ´SidiYahia(Bejaia,GraKabylie) g n spri ure nhot mplemperatC) –60 –60 eria Sate((cid:3) 70 50 50 39 70 45 45 60 70 54 53 70 52 g cteristicsoftheAl Natureofsample Thermalwater Thermalsediment Thermalwater Thermalwater Thermalsediment Calciteconcretion(Fig.1a) Calciteconcretion(Fig.1b) Microbialmat(Fig.1c) Calciteconcretion(Fig.1d) Calciteconcretion(Fig.1e) Thermalsediment Thermalsediment Thermalsediment ds Generalchara Samplename St1P St3S St4P St5 St7S St7C1 St7L St7T St7–70 St8 St10 St13 St16 dissolvedsoli Table1 Samplingsite St.1 St.3 St.4 St.5 St.7 St.8 St.10 St.13 St.16 TDStotal 123 Extremophiles 4 0 3 6 Morphological classification of cyanobacteria 1 3 2 9 Mn 0 0 0.0 0 0.0 0 0.0 0 0.1 and enrichment cultures ? 7 49 Morphological classification of natural and cultivated 3Al 0 0 0 0.2 0 0 0 1.3 0 cyanobacteria was based on characters observable under a light Zeiss microscope (400–10009) and photographed 2?Zn 0.151 0 0.150 0.152 0 0.01 0 0 4.459 wphitohtypaessuwpeerreHiAdeDn/tCifiCedD-dSoownyn–tDoStChe-Sg9e3n0uscalmeveerla.onMtohre- basis of the identification systems proposed by Koma´rek 2 2 5 1 and Anagnostidis (1989, 1999) and Castenholz (2001). 1 0 4 3 2 8 Fe 1.5 0.0 0.0 0.1 0.1 6 1.9 0 1.9 Cyanobacterial cells were counted from each sample three times using a Nageotte counting chamber on 50 ll of a -Br 4 2.17 2.15 2.4 2.1 2.5 4 3.06 1 hmoemntogoerncizoendcrseutisopne,nsoironfroombta1inmedl forfomwa1tegr poefrmliatte,r.seWdie- took into account the cell number of filaments and colo- 2 7 4 - 5 1 6 7 5 9 5 nies. Species diversity was calculated using the Shannon– F 3 0. 1. 2. 2. 2. 3 1. 1. Weaver index (Shannon and Weaver 1963). Cultivation 5 1 5 and isolation attempts were conducted in liquid BG-11 ?Li 6 2.05 2.06 1.63 1.16 4 2 1.28 3 medium and on agar plates of BG-11 medium, using incubation temperatures of 40, 45 and 55 (cid:3)C. Fluorescent ? 5 tubes were used for illumination (2500 lux). When 2 1 6 4 3 5 1 Sr 4 2. 2. 8. 3. 8 4. 5. 3 cyanobacterialgrowthwasobserved,onesinglefilamentor colony was transferred to 20 ml of fresh medium and SiO2 52.8 36.8 38 19.2 54.9 41.4 42 50.6 39.9 incubated until growth occurred. DNA purification, PCR amplification, cloning - 3 and sequencing s O g C 9 7 2 1 6 1 9 5 7 sprin H 56 29 34 92 36 53 52 71 65 DNA was purified from subsamples of approximately hot - 2 6 6 2 8 200 ll of homogenized microbial mats or cell pellets of gerian NO3 0.03 4.4 8.9 0.66 0.00 0.03 0.59 0.1 0.18 eknitri(cMhmoBeniot,cCulatrulrsebsadu,siCngAthUeSPAo)wfeorlBloiwofiinlmg mDaNnAufaiscotularteiro’ns Al nalyzed 2-SO4 1.025 296 452 13 368 1.414 1.628 50 1.689 ipannlsudtsrcutohcnteisoeandrsvj.aecDdeNanttA-ITw2S0asw(cid:3)Ceelr.ueCteaydmainpnolib1fia0ec0dtelbrliyaolpf1oT6lySrimsr–ReHrNaCsAel,gcpehHnaein8s a of 4 6 4 0 8 reaction (PCR) using the specific primers CYA106F (50- mg/l) -Cl 8.48 678 541 670 308 9.90 5.49 1.66 9.92 CGGACGGGTGAGTAACGCGTGA) and 23S0R (50- CTTCGCCTCTGTGTGCCTAGGT). PCR reactions were ( s ponent ?K 207 18 12 17 25 100 62 50 93 cthaerrieelduteodutDinNA25, 1l.l5omfMreaMctigoCnl2b,udffNeTr,Pcson(1ta0innimngol1elaclho)f, m 20 pmol of each primer, and 0.2 U Taq platinum DNA o waterc ?Na 5.316 602 650 417 229 5.405 3.573 1.048 6.568 puonldyemrethraesefol(lIonwviitnrgogceonn)d.itPioCnRs:r3e5acctyiocnlessw(deerneatpuerraftoiormneadt al 94 (cid:3)C for 15 s, annealing at 55 (cid:3)C for 30 s, extension at orminer 2?Mg 54 23 18 34 33 86 99 40 131 7an2d(cid:3)Cfolfloorw2edmbiny)7p-rmeciendeexdtebnysi2o-nmaint 7d2en(cid:3)aCtu.r1at6iornRNatA94ge(cid:3)nCe, min % libraries were constructed for all positive amplifications and 2?Ca 439 64 110 286 220 901 520 159 605 B5 uUsSinAg)tahcecoTrodpinogTAtocthloenminagnkuiftac(tIunrveirt’rsogiennst,ruCcatrilosnbsa.dC,lCoAne, or or Maj err inserts were PCR-amplified using flanking vector primers, ng al and inserts of expected size were partially sequenced Table2 Hotspri St.1 St.3 St.4 St.5 St.7 St.8 St.10 St.13 St.16 Analytic (cBifiecckcmyaannoCbaocutleteriralGerenvoemrsiecs,prTimakeerleCy,YUAK-1)3w80itRh,thloecaspteed- 123 Extremophiles towards the end of the 16S rRNA gene (50- TA- (St16), Be´ni Gue´chat (St8), Iba¨ınen (St10) and El Bibanes ACGACTTCGGGCGTGACC). A total 13 gene libraries (St1) indicate leaching of subsurface evaporite deposits. were constructed and 292 gene sequences determined. Oursamplescanbeclassedintwogroupsaccordingtothe Sequences were deposited in GenBank with accession conductivity-based classification proposed by Issaadi numbers KJ659374–KJ659422. (1992). Class 2 includes thermal springs with conductivi- ties between 2 and 7.5 mS/cm. Five springs St3, St4, St5, Sequence analysis St7 and St13 belong to this class. They are either enriched inbicarbonatesodiumchlorideorincalciumsulfatewaters 16SrRNAgenesequencesretrievedfromoursampleswere rich in sodium chloride. Class 4 includes springs with comparedwithsequencesinthedatabaseGenBank(http:// conductivities higher than 15 mS/cm, where the mineral www.ncbi.nlm.nih.gov/) and in the curated SILVA data- content is essentially of evaporite origin. They are rich in base(Pruesseetal.2007)byBLAST(Altschuletal.1997). sodium chloride and calcium sulfate. Four springs belong Our sequences were considered to belong to the same to this class, St1, St8, St10 and St16. operational taxonomic unit (OTU) when they shared more Theresultsofmajorandminorcomponentsarelistedin than 97 % identity. We retrieved the closest sequences Table 2.Thethermalsprings,St1,St7,St8,St10,St13and found in databases and included them in an alignment St16, share several physico-chemical characteristics, containing also sequences from the closest cultivated including high temperature, slightly acid pH, high con- members and some representative sequences of major centration of sodium chloride, calcium sulfate and silica, cyanobacterial taxa. Sequences were aligned using MUS- high mineral andgascontent(Issaadi1992).Theyare also CLE (Edgar 2004). Ambiguously aligned positions and quite enriched in minor elements, notably strontium, lith- gaps were eliminated using Gblocks (Castresana 2000). A ium, fluorine, bromine and iron, due to the leaching of total of 761 conserved positions were retained for the reservoir rocks, especially the Be´ni Gue´chat spring (St8). subsequentanalysis.Theresultingsequencealignmentwas At Tassa spring (St5), with the lowest temperature among used as input to build a phylogenetic tree by maximum the studied sites, the water contains reduced gases and a likelihood using Treefinder (Jobb et al. 2004) with a characteristic odor of H S due to sulfate reduction. This 2 General Time Reversible (GTR) model of sequence evo- makesthesewatersslightlyacidic(pH6.07).Theyarealso lution, and taking among-site rate variation into account the most strontium rich. using a four-category discrete approximation of a C dis- Because iron is an important limiting factor for cyano- tribution. ML bootstrap proportions were inferred using bacteria,wealsoanalyzedtheironcontentinthesediments 1,000 replicates. Trees were visualized with FigTree in comparison with the thermal waters (Table S1). Cya- (http://tree.bio.ed.ac.uk/software/figtree/). nobacteria assimilate dissolved Fe3? and, in environments where dissolved Fe3? is too low, many cyanobacteria possesssiderophoresfavoringitsuptakeoritsmobilization Results and discussion from chelates (Hopkinson and Morel 2009). The Algerian hot springs have very different levels of iron in water, Physico-chemical parameters and mineral composition ranging from 0 to 6 mg/l (Table 2), which might have an of hot spring waters influence on the cyanobacterial diversity associated to the springs. However, many of the cyanobacteria in these The physico-chemical parameters measured in situ at the springs were benthic and, therefore, associated to the different hot spring samples are reported in Table 1. The mineral substrate. Although in general there was a good temperatures of thermal waters vary between 39 (cid:3)C mea- agreementbetweenironconcentrationsinthesedimentand suredatTassa(St5)and93 (cid:3)CatMeskoutinespring(St7), in the water (Table S1), in some cases there were sub- which is the hottest spring in Algeria. The pH of the ana- stantial differences. For instance, samples St4 and St7C1 lyzed water samples is in a narrow range (6.02–7.10), had high sediment iron content (82.5 and 96 g/kg, neutral and slightly acid. These waters have high gas respectively), but very low water iron concentrations content and gas emission was observed during sampling. (Table S1). It would be interesting, though it is challeng- CO isthemostabundantofthosegases,constitutingupto ing, to ascertain the real amount of bioavailable iron for 2 59 % of total emissions, followed by nitrogen (Issaadi these cyanobacteria to establish potential correlations 1992). Conductivity values vary from 2 to 28 mS/cm, between iron availability and cyanobacterial diversity. reflecting a high mineral content due to deep subsurface Likewise, it would be interesting to see whether different mineral dissolution by thermal waters. Accordingly, the physico-chemical parameters interfere mutually and may total dissolved solids vary from 1.1 to 17.5 g/l. The influence the cyanobacterial composition. This would important amount of mineral salts in springs of Sidi Yahia require the inclusion of the same type of metadata 123 Extremophiles C) 3 5 2 18 6(cid:3) ± ± ± ± St1(52 18 ? 27 ? 10 ? 89 ? C) ±142 17.6 ±85 ±37 ±27 St13(70(cid:3) 716 ? 88± ? 428 ? 184 ? 134 ? 6 5 9 2, ± C) 4 St10(53(cid:3) 14,78 ? s g 4 prin C) ±90. ±26 ±27 s (cid:3) hot St8(54 452 ? 132 ? 136 ? nineAlgerian St7–70(70C)(cid:3) 25,573±5,114 ? 5,056±1,011 ? in 28 99 es 2,7 3,3 ci ± ± phospe St7T(60C)(cid:3) 13,642 ? 16,996 ? mor 45 8 1 4 4 3 obacterial St7L(45–60C)(cid:3) 17,229±3, ? 5,743±1,1 ? 7,657±1,5 ? n cya C)(cid:3) 110 uesof St7C1(45–60 552± ? val 60 5 yindex St7S(70C)(cid:3) 2,800± ? versit C) ±58 biodi St5(39(cid:3) 288 ? d g-1)an St4P(50C)(cid:3) 4±0.8 ? 5±1 ? 7±1.4 ? or 04 1 310cellsl-1 St3S(50C)(cid:3) 120,523±24,1 ? 51,756±10,35 ? 700±140 ? 621±124 ? ( e 0 undanc St1P(70C)(cid:3) 60±12 ? 100±2 ? b na ure n,mea Culturetemperat(C)(cid:3) 45–55 45–55 45–55 40–45 45–55 45–55 45–55 45–55 45–55 45–55 45–55 45–55 40 45–55 40–55 40–45 40 40 40 o Table3Distributi Morphotype Leptolyngbyasp. Leptolyngbyafoveolarum Leptolyngbyalaminosa Leptolyngbyaamplivaginata Gloeocapsasp. Gloeocapsagelatinosa Gloeocapsopsiscrepidinum Stigonemasp. Fischerellasp. Fischerellathermalis Synechocystisthermalis Synechococcuselongatus Synechococcusnidulans Cyanobacteriumsp. Microcoleussp. Chroococcusminutus Geitlerinemasp. Cyanodictyonsp. Anabaenopsissp. 123 Extremophiles St16(52C)(cid:3) 144±29 1.52 ‘plus’sign. ammsousorltecivihaaotretidastpetorsintcagytsiasnaticocrbaoalscsatnetahrileaylswedosi.rvledrstoitycasrtruydoieustfmroemanimngafnuyl a 310 by St13(70C)(cid:3) 1,150± 1.416 indicated Iodfecnytiafincoabtaiocnte,rqiaulamntoifirpcahtoiospneacniedsenrichment is 2,956 prings Using optical microscopy, we identified 19 distinct mor- St10(53C)(cid:3) 14,784± 0 gerianhots psphroinspgesc.iWeseocfocuynatendobcaecltlenriuamibnerthseindtihffeerdeinffteArelngtersiaamnphleost Al and made biodiversity estimates for cyanobacteria in the St8(54C)(cid:3) 720±144 1.32 thestudied dHioffwereevnetr,hthoetsespersitnimgsatebsassehdouoldnbethteaskeenvwaliutehsca(uTtaiobnled3u)e. m to the high heterogeneity of the studied systems. This is o fr ure exemplified by the variation in counts and diversity of St7–70(70C)(cid:3) hedincult mMoerspkhooustpineecisepsriindgen(Stitfi7esdaimnptlhees;sTubabsalem3p)l.esRecmolalercktaebdlyf,rowme nric wereabletoenrichallthemorphospeciesidentifiedinfield e St7T(60C)(cid:3) orphospecies s(thTaemabsplaleems3e;FcautigltuuterremeSpm2e,eradSti3uu)rm.esA(lBlrGathn1eg1ie)nngsruicgfhgrmoemsetnintsg40wtheartteo,ddo5ens5pe(cid:3)iitCne m considerable differences in water and substrate chemistry, St7L(45–60C)(cid:3) ofcyanobacterial tcKhohenesdenictcihoyenalsan.oT(bShatec3tSsea)r,imaSpcildeaisnfYarodamhapiatBot(oSuth1da6idf)fjeawrree(nSrtet1es3nl)iv,giEhrotslnsyamlmiehnoitnraeel n diverse, with 4–5 morphotypes identified, followed by St7C1(45–60C)(cid:3) ±6,129 mes.Thedistributionce M7tcyo0per)res,eksBsoiped´uonetniinndtGeiefiduhee´odcttoh(sTapfitarlb(ianSlmegt8e3)(n)St.aotTn7udShs,eKcSmnyt7ioafCnst(o1Sab,tba4SucPtnt7e)d,Traiw,anStitomth7foL3trhpamehnoodgrtpeySnhptuoe7ss-- St1PSt3SSt4PSt5St7SCulturetemperature(70C)(50C)(50C)(39C)(70C)(cid:3)(cid:3)(cid:3)(cid:3)(cid:3)(C)(cid:3) 160±32173,600±34,72016±3.2288±5830,629 0.9540.9471.54602.716 ortemperaturegradientofcollectedsamplesisindicatedinbracketsundersamplenandtospeciesthathavebeenalsounequivocallyidentifiedby16SrRNAgeneseque icttfpaSs(o4umsLfeshhoTopaooemb5nteoievom8l,nralpt–irllpyeaaacsbtoacCt5patoeltierotrlwi5unnlueyelelepvldialredynaemtnauao(cid:3)e1irdndSngrCgloms,uS)gtayorpin.im,tranbnLdcibs1rswnnayeiuii.ya.6ctncadAgactlnie.yaltLatgtohesdayehcSaArwemoodcmslynwopayctaowninoifitttomenttrneohbtLehhdscrha4c7olarpeepeeciytehf0e0scnp,eluonaeo–ltadgtsoeug(cid:3)rsiosc4ntlserCwrboeayolt5dsniosyhylmna,ctespilinuea(cid:3)AddcadaprepgrCd(utnuenctmtFeebsisLhedcl,tatedrpaiyihmiea.agbdvCe.anaeylatua.eispa,usnhrlwnw,relTs,memrwdryenoearLooada,mpaaeostogeoSnGlltreipipacieumned3sdrivsljottnros)oeoiaohpeisca.scltentergelaahrmceunyiooaTersmitetucbnrnetfpcysphwtiseagdpeaa.ecl44edtnebiltdphfmTi0s5teasrftoyshe–sorh,iaaniG(cid:3)ion.t6m(nenLChgFmuwIe0s.ewenc,ttiipshrlhugntmo(cid:3)iwaa.iltexetsue,CtnehnmhhairerrrcLsehegeaatieoiirosnrca.none,nefaltsosdteSotaefnaaitiouttmstmte2onnghheeoLLvlas)nadddeeess--ft,,.. Table3continued Morphotype Totalnumberofcyanobacterialcellsinfieldsamples Biodiversityindex(bits.cell-1)perhotspringsite TheoriginaltemperatureShadowedcellscorrespo sriSInebctsuh7ap¨ımeCner1eceantlfnilrvasdoepmlrCyin,y(MgSathtenciesogokboncoantouacecittmnicenoeraediitudasomlpecnrsolis)ynlpogo.nnaiMwaneldeemrmGteohlbreoepershocseohcdtoaaiyfmrppasteecohntwpeetsrhfgiirizsecoenhcmdurwesSpetFir1bdei0y--, 123 Extremophiles Fig.1 Selectionofthermalspringsamplesanalyzed.CalciteconcretionsandbacterialmatsfoundinSt7Meskoutinespring:aSt7C1,bSt7L, cSt7T,dSt7-70;andfromSt8BeniGue´chatspring(e).Scalebar,1cm filamentous trichomes with true branching. Interestingly, notably,atmuchhighertemperaturesinsomethermophilic the two Fischerella strains enriched from, respectively, and hyperthermophilic archaea (Sen and Peters 2006; St.3 and St16 (Table 3) were able to form heterocysts at Mehta and Baross 2006). 50 (cid:3)C in culture, indicating that nitrogen fixation is pos- The diversity of cyanobacterial morphospecies identi- sibleatthattemperature.Sincethestrainsgrowwellinthe fied in the Algerian hot springs is in general agreement range 45–55 (cid:3)C in normal BG11 medium, it may well be with that observed by pioneers of thermophilic cyanobac- that they are able to fix nitrogen in the same temperature terial research decades ago in the Yellowstone National range. Heterocyst-containing cyanobacteria have been Park (Castenholz 1969; 2008). One of the dominant observed in natural samples at 45 (cid:3)C (Coman et al. 2013) Algerian morphotypes corresponded to the genus of fila- andupto63 (cid:3)C(Ionescuetal.2010).Nitrogenfixationcan mentous cyanobacteria Leptolyngbya, which has been occur not only in some thermophilic cyanobacteria, but detectedinhotspringsworldwide(e.g.,Ionescuetal.2010; 123 Extremophiles OTU_1 Gloeomargarita clade *St7T-1CY OTU_11 Stigonematales OTU_2 *St7.70-1CY OTU_3 Chroococcales *St7L-1CY OTU_8 OTU_20 St16-1CY OTU_4 Synechococcus- like St13-1CY OTU_5 OTU_6 St10-1CY OTU_7 St8-1CY OTU_9 OTU_10 * St7C1 OTU_12 Oscillatoriales OTU_13 St5-1CY OTU_14 St4-1CY OTU_15 OTU_16 St3S-1CY OTU_17 St1P-1CY OTU_18 OTU_19 0% 20% 40% 60% 80% 100% Fig.2 Diversityandrelativeproportionsofcyanobacterial16SrRNAgene-basedOTUsingenelibrariesobtainedfromenrichmentculturesand naturalsamples.Environmentalsamplesarelabeledwithanasterisk Comanetal.2013;Dadheechetal.2013;Mackenzieetal. rRNA gene-based operational taxonomic units (OTUs) 2013). Another important morphotype systematically and, eventually, validate and/or refine morphological associated with hot springs is that of Synechococcus/ studies. We identified a total of 20 OTUs (Fig. 2; Table Thermosynechococcus spp. The occurrence of Lep- S2), which correlates well with the number of morpho- tolyngbya, Synechococcus and other cyanobacteria often species(19)previouslyidentified.TheseOTUsaffiliatedto found in most springs (e.g., Fischerella/Mastigocladus) five order-level cyanobacterial clades, namely the Oscill- might suggest that there is no geographical barrier to the atoriales, Chroococcales, Stigonematales, one clade of dispersal of these thermophilic taxa. However, analysis at Synechococcus and the recently identified Candidatus finer scales seems to suggest that, despite apparent cos- Gloeomargarita clade (Couradeau et al. 2012). Nonethe- mopolitan distribution under particular strong environ- less, three groups were found to dominate the different mental selection, these organisms experience isolation by enrichments or natural samples, the Oscillatoriales (St1P, distance (Papke et al. 2003). Nonetheless, disentangling St3S, St8, St13, St16, St7T), the Chroococcales (St5, geographicaldistancefromphysico-chemicalparametersis St7c1, St10) and the Synechococcus-like, which were not easy and more in-depth studies will be required to dominant or very abundant in several natural samples properly test this hypothesis. collected at Meskoutine (St7) (Fig. 2). It is interesting to note that the relative abundance of sequences in gene Diversity of cyanobacteria based on 16S rRNA gene librariesfromenrichmentsandthenaturalSt7sampleswas sequences in relative good agreement with counts of cyanobacterial morphospecies from field samples, at least in terms of We also studied the cyanobacterial diversity by amplifi- dominance of large cyanobacterial groups (Figure S4). cation, cloning and sequencing 16S rRNA genes from the Therewereonlyafewexceptions(St7-70andSt7L)where different enrichment cultures as well as from various nat- Chroococcales appeared to dominate in gene libraries ural mats and mineral crusts associated to the hottest St7 whereas Oscillatoriales seemed to dominate in morphol- Meskoutine spring, i.e., samples St7T, St7C1, St7L and ogy-basedcounts.However,thiscanbeeasilyexplainedby St7-70 (Table 1). This molecular analysis should serve to local spatial heterogeneity. Collectively, the diversity and compare previously identified morphospecies with 16S relative abundance for all St7 samples observed 123 Extremophiles morphologically seem compatible with that found by Fig.3 Maximumlikelihoodphylogenetictreeofcyanobacterial16Sc molecular analysis. rRNA gene sequences retrieved from Algerian hot springs. The different colorscorrespond tothoseusedinFig.2.Bootstrapvalues The agreement of molecular and morphological obser- higher than 50% are shown at nodes. The scale bar indicates the vations was also good at finer level. As shown in Table 3, numberofsubstitutionsperaunitbranchlength for 18 identified morphotypes, there was a perfect corre- lation between the morphospecies identification and the analyses to differentiate between the various Synechococ- occurrenceofthecorrespondingspecific16SrRNAgenein cus-likelineages.Thismayleadtomakeabetterlinkwith gene libraries (Table S2), the phylogenetic position of their ecology. For instance, it has been noted for a long which was demonstrated by the reconstruction of a phy- time that the most thermophilic cyanobacteria are Syn- logenetic tree (Fig. 3). In the cases where only one mor- echococcus-like(DyerandGafford1961;Castenholz1969; photype was observed (the two enrichments St5 and St10 Miller and Castenholz 2000). However, Synechococcus is andthetwonaturalsamplesSt7C1andSt7S),alltheclones also typical of much colder environments, namely oceans, analyzed yielded 16S rRNA gene sequences that matched but molecular phylogenetic analyses show that oceanic well the observed morphospecies. These were Synecho- Synechococcus form a distinct cluster (Robertson et al. coccus nidulans for St5, Cyanobacterium sp. for St10 and 2001; Zwirglmaier et al. 2008). Gloeocapsopsis crepidinium for the natural sample St7C1 Interestingly, we identified sequences related to Can- (Table 3;Fig. 3;TableS2).Inagreementwiththenatureof didatus Gloeomargarita lithophora in concretions and its substrate, G. crepidinium was described by Koma´rek microbial mats of the St7 Meskoutine spring, constituting and Anagnostidis (1999) as forming agglomerates of up to 12 % of the clones in microbial mat libraries. irregular packets surrounded by mucilaginous envelopes AlthoughCa.G.lithophorawasisolatedfromafreshwater andinhabitingmainlystonysubstrates.InthecaseofSt7S, microbialite andgrowswell at20–25 (cid:3)C(Couradeau et al. the 16S rRNA gene sequence of Leptolyngbya laminosa 2012), its closest relative sequences in databases corre- was obtained after direct amplification and sequencing, spond to sequences retrieved from thermophilic microbial withoutcloningsteps,whichfurtherreinforcestheideathat mats in Yellowstone or Tibet hot springs (Fig. 3). The this species is largely dominant in this sediment sample. earliest branching sequence to the whole Gloeomargarita In several cases (14 out of 32 occurrences), there was clade is also a sequence identified in thermal springs in not a clear correspondence between the morphospecies Jordan(tBTRCCn_301;Ionescuetal.2010).Thissuggests identified and the sequences retrieved. There are several that the ancestor of this clade was a thermophilic cyano- explanationstothis.First,forsomecyanobacterialspecies, bacterium thriving in microbial mats. especially for Gloeocapsa gelatinosa, which was not In addition to the presence of Ca. G. lithophora rela- detected by sequence, it may be that the cellular lysis was tives, the hottest Algerian spring of Meskoutine was prevented or limited by its thick mucilaginous capsule, essentially dominated by one Synechococcus-like clade, biasing subsequent DNA purification and gene amplifica- OTU 4, which, similar to Gloeomargarita, has as closest tionsteps.Second, insomecases, weidentified16SrRNA relative sequences 16S rRNA genes amplified from Yel- gene sequences that were very divergent from described lowstone and Tibet hot springs as well as from Alchichica morphospecies, so that their correct identification is not microbialites, Mexico (Couradeau et al. 2011). This OTU possible due to the lack of good reference morphospecies. mademorethan80 %oftheclonesinthegenelibraryfrom This was the case, for instance, of OTUs 9 and 10, which thehottestcollectedsample,St7-70(70 (cid:3)C),indicatingthat had only 91–93 % identity with the closest sequences in this phylotype corresponds to extreme thermophilic cya- the database (Table S2; Fig. 3). Finally, in most cases, the nobacteria. In addition to these two unicellular highly absence of a direct unequivocal correspondence between thermophilic OTUs (Synechococcus and Gloeomargarita- morphospecies and 16S rRNA gene markers occurred in like), the other most thermophilic cyanobacteria were fil- caseofmorphospecieswithlittlemorphologicaldistinctive amentous Oscillatoriales belonging to the genus Lep- features. Thus, we did not retrieve sequences belonging to tolyngbya (Table 3; Fig. 3). Again, the closest relatives to Synechococcus elongatus or S. thermalis, but we detected those sequences came from hot spring associated mat othersequencesthatbelongtootherSynechococcusspecies clones (Fig. 3). At lower temperature springs, cyanobac- or to Synechococcus-like cyanobacteria (Fig. 3). This terial diversity was dominated by different species of Os- illustrates well the fact that a single apparent morphospe- cillatoriales and Chroococcales (Fig. 2). ciesmayhinderalargegeneticdiversityandexplainswhy the genus Synechococcus is polyphyletic, encompassing at Concluding remarks least 8 different clades distributed across the phylogenetic tree of cyanobacteria (Robertson et al. 2001). This also The cyanobacteria identified in water, microbial mats and highlightstheneedofcarryingoutmolecularphylogenetic concretions associated to various Algerian hot springs 123

See more

The list of books you might like