Logout succeed
Logout succeed. See you again!

Integrin Protocols PDF
Preview Integrin Protocols
MMeetthhooddss iinn MMoolleeccuullaarr BBiioollooggyy TTMM VOLUME 129 IInntteeggrriinn PPrroottooccoollss EEddiitteedd bbyy AAnntthhoonnyy HHoowwlleetttt HHUUMMAANNAA PPRREESSSS Phage Libraries of Integrin-Binding Peptides 3 1 Integrin-Binding Peptides Derived from Phage Display Libraries Erkki Koivunen, Bradley H. Restel, Daniel Rajotte, Johanna Lahdenranta, Martin Hagedorn, Wadih Arap, and Renata Pasqualini 1. Introduction 1.1. Use of Phage Display Libraries in Integrin Research Integrins are a family of cell-surface receptors that recognize extracellular matrix proteins and mediate cell adhesion. Certain integrins bind to proteins containing the sequence Arg-Gly-Asp (RGD; ref. 1). Such RGD-binding integrins include (cid:95) (cid:96) , (cid:95)v(cid:96) , (cid:95) (cid:96) , and (cid:95) (cid:96) (2,3). Peptide libraries dis- 5 1 3 v 5 IIb 3 played on filamentous phage have provided a straightforward method to char- acterize the peptide-binding specificity of these integrins. In phage display-based strategies, libraries of random peptides are expressed on the sur- face of bacteriophage. Each individual phage carries a single peptide. The pep- tide is fused to the phage capsid protein pIII by insertion of its encoding DNA sequence in the pIII gene of the phage genome. Libraries displaying peptides fused to the major capsid protein pVIII have also been used. Libraries using the pIII protein display 3–5 copies of each individual peptide whereas libraries using the pVIII protein display approx 3000 copies (4,5). Analysis of the phage- displayed peptides found during screenings on purified integrins revealedthat the majority of the integrin-binding peptides contain an RGD motif (6–11).Other interesting ligand motifs were also found in the remaining population of integrin-binding peptides. Conversely, panning on immobilized fibronectin fragments containing the RGD sequence revealed peptide motifs present within integrins(12). We describe here strategies for the use of phage display libraries From:Methods in Molecular Biology, Vol. 129: Integrin Protocols Edited by: A. R. Howlett © Humana Press Inc., Totowa, NJ 3 4 Koivunen et al. in cell-adhesion research, with emphasis on the peptide-binding specificity of different members of the integrin family. 1.2. Display of Peptide Libraries on Bacteriophage A major advantage of phage display-based strategies is that peptides capable of binding to integrins can be isolated quickly by using a simple general proce- dure (Fig. 1). Samples of libraries displaying different degenerate peptides can be analyzed in the same experiment. It is useful to employ a series of libraries each displaying peptide inserts of different lengths, compositions, and struc- tures. This approach enhances the probability of finding a specific ligand to an integrin. Phage clones that show the highest avidity to integrins will gradually enrich following each round of “biopanning,” resulting in the isolation of novel peptide ligands (10). The libraries can be used individually or they can also be pooled and used in a single experiment. However, because clones having a lower growth rate in bacteria may be lost by amplifying a mixture of heteroge- neous phage libraries, we currently tend not to pool the different libraries in a single screen. The first peptides to be displayed on phage libraries were degenerate linear hexapeptides and decapeptides (13–15). Subsequent work indicated that the binding affinity of phage-displayed peptides to integrins, as well as to other targets, were markedly improved if the peptides were conformationally con- strained by a disulfide bond formed by cysteines flanking the peptide insert (6–11). Integrin-binding peptides containing up to four cysteines, thus potentially capable of forming two disulfide bonds, have also been isolated during pan- ning on integrins (10). Libraries engineered to display such double-cyclic pep- tides have then been used successfully to find ligands to integrins and other receptors (6–11). One such peptide, RGD-4C (10), has been shown to bind to (cid:95)v integrins in vitro (10) and in the angiogenic endothelium of tumor blood vessels (16), in which (cid:95)v integrins are upregulated. RGD-4C has also been used to deliver a cytotoxic drug to the tumor vasculature in an animal model (17). The number and diversity of individual clones present in a given library will influence the success of the screen. With current library-making techniques, the maximum number of individual clones obtained is approx 109. This means that the diversity of the peptide sequences present in a library is limited. If the random insert is seven residues or longer, only a portion of all possible permu- tations of such peptides is actually displayed. The preparation of the librar- ies—a critical factor—has to be optimized so that the number of recombinants is as high as possible. It is important to ensure that practically every phage in the library carries an insert. Insertless phage cannot be totally avoided, but they usually cause no problems and can be eliminated in the display systems and biopanning by using stringent phage selection procedures. Phage Libraries of Integrin-Binding Peptides 5 Fig. 1. Phage display peptide library screening. The procedure consists of the fol- lowing sequential steps: screening the library on a specific target such as an integrin (upper panel); washing to remove nonspecific interactions, elution of the bound phage from the target, and amplification of the eluted phage (middle panel); and identifica- tion of the binding peptide by sequencing of the phage DNA (lower panel). 6 Koivunen et al. 1.3. Purification of Integrins Integrins isolated in their active state and free of contaminating proteins are suitable targets for phage library screenings. Placenta has been the tissue most commonly used to purify human integrins (18). For preparation of RGD-directed integrins, two affinity chromatography-based methods have been described. In one method, the integrin-binding peptides KGRGDSP or CRRETAWAC are coupled to Sepharose, and the integrins that bound to the affinity matrix are eluted with EDTA or a competing integrin-binding peptide (9,18). In an alter- native method, integrins are captured by using specific antibodies coupled to Sepharose (8). Integrins can be eluted from the antibody matrix by low- or high-pH buffers, followed by immediate neutralization of the eluted fractions. If the antibodies are directed against the cytoplasmic portion of an integrin, the corresponding cytoplasmic peptide provides an effective elution strategy (8). As integrins are glycoproteins, further purification—if needed—can be accom- plished with wheat germ agglutinin lectin affinity chromatography (18). Integrins retain activity when coated on microtiter wells. The activity of the immobilized integrins can be tested by using a labeled ligand. For example, iodinated fibronectin has been used with the (cid:95) (cid:96) integrin (7). 5 1 Phage library selections have been performed with integrins coated on plas- tic. Alternatively, integrins can be immunocaptured on microtiter wells precoated with antibodies directed against the integrin cytoplasmic domain. Such immunocapture procedure is not suited for the primary selections with phage libraries, as antibodies avidly bind phage. Thus, an antibody-binding rather than integrin-binding phage may be enriched. During the selection pro- cess, however, the immunocapture assay helps to demonstrate the specific bind- ing of an individual phage to a particular integrin species (8,9). 1.4. Selection for Integrin-Binding Phage In the first round of selection, optimal results are achieved by incubating the phage libraries with the immobilized integrins overnight at 4°C. This longer incubation time will enhance the probability to select multiple integrin-binding clones. In subsequent rounds of pannings, the incubation time can be decreased to 1 h because the selected population is amplified so that multiples copies of each clone are present. The bound phage can be eluted specifically by an RGD- containing peptide or by the cation-chelator EDTA. Both methods will dissoci- ate integrin-bound ligands. The phage can also be eluted nonspecifically with a buffer solution of pH 2.2. The eluted phage do retain their infectivity after neutralization of the pH. The binding affinity of different phage clones to integrins can be compared in a phage-attachment assay (7–9). High-affinity clones are favorably selected when the integrin coating concentration is decreased in each panning because Phage Libraries of Integrin-Binding Peptides 7 the phage clones compete for a limited number of binding sites. A way to recover the best binders is to search, in each round of selection, for the minimal integrin concentration yielding at least a 10-fold enrichment above background. Usually, the best binders become evident by appearing more frequently during the third and fourth rounds of pannings when a representative number of clones (100 or more) is sequenced. 1.5. Sequencing of the Phage Insert The sequence of the integrin-binding peptide is determined by sequencing the region of the phage genomic DNA that encodes the displayed peptide (5). In most display systems, peptides are inserted near the amino terminus of the minor capsid protein pIII. When the phage single-stranded DNA (ssDNA) is directly used for sequencing, the primer used for the sequencing reactions should be located approx 100 bp from the peptide insert site. However, the direct sequencing of phage ssDNA prepared by standard methods often gives high background, and many sequences may be unreadable. An alternative approach is to sequence a double-stranded DNA (dsDNA) PCR product of the phage rather than the ssDNA itself. The sense and antisense primers used in the PCR are at 100 bp from the DNA sequence encoding the peptide. Sequenc- ing is then carried out using the same sense PCR primer, or a nested primer. 1.6. Reproduction of Phage Displayed Motifs as Synthetic Peptides Only those phage-displayed peptides that show at least 100-fold stronger binding to integrins relative to albumin may be worthy of reproduction as recombinant or synthetic peptides. The solubility properties of a peptide are not always predictable based on the amino acid sequence. Aromatic and hydro- phobic residues tend to decrease solubility of peptides in aqueous buffers, whereas charged residues tend to have an enhancing effect. Tryptophan is an amino acid residue that is relatively rare in naturally occurring protein sequences but is encountered repeatedly in highly active phage library-derived peptides. The integrin-binding peptides CRRETAWAC and CRGDGWC are two examples of such peptides (8,10). Tryptophan may be favored in phage library-derived peptides because it provides a hydrophobic scaffold and it improves the binding activity of a displayed peptide. Cyclic peptides can be restricted to a structure favorable for integrin binding because the presence of a disulfide bridge constrains its conformation. How- ever, making the disulfide bridge complicates the peptide synthesis. Disulfide bonds usually form by air oxidation, but some peptides may need a treatment with an oxidant or dimethyl sulfoxide (DMSO). Fortunately, oxidation of phage library-derived synthetic peptides usually proceeds rapidly, because the pep- tides often adopt the energetically favorable conformation they have on the 8 Koivunen et al. surface of phage. In fact, in our experience, it has been far more problematic to prepare scrambled versions of the phage library-derived cyclic peptides; the scrambled sequences may not possess a similar solubility or structural features as the parent peptide. A unique problem occurs when a peptide contains four cysteines, such as CDCRGDCFC, which is capable of forming alternative dis- ulfide bonds (10,16,17). We have found that multiple forms of the peptide can be obtained by random oxidation of the peptide without directing the forma- tion of specific disulfide bonds. However, we have found that one arrangement of the disulfide bonds is more active than the other conformers when each form is synthesized individually (Assa-Munt et al., in preparation). 1.7. Testing the Anti-Adhesive Activities of Integrin-Binding Peptides Integrin-binding peptides can be analyzed in two different types of cell-adhe- sion assays (3–5). In the first experimental design, the peptide is tested for its ability to inhibit cell adhesion because it competes for the ligand-binding site of the cell surface receptor. The peptide is added to the culture media under serum-free conditions. Depending on the integrin studied, the adhesion sub- stratum can be fibronectin, vitronectin, or other matrix proteins. The peptide is then tested for inhibition of cell attachment. In the second type of assay, the peptide is immobilized on a microtiter plate and used as the adhesion substra- tum. Other cellular functions can be tested in vitro such as cell migration, pro- liferation, and apoptosis. Phage-display derived integrin-binding peptides can also be tested for their ability to block integrin function in vivo. For example, we have shown that certain integrin-binding peptides isolated by using phage display have an antimetastatic activity (19). 2. Materials 2.1. Construction of Phage Display Peptide Libraries 1. TE: 10 mM Tris-HCl at pH 7.5, 1 mM EDTA, autoclave. 2. SOB media: 20 g bacto-tryptone, 5 g bacto-yeast extract, 0.5 g NaCl, 10 mL of 250 mM KCl. Adjust pH to 7.0, the volume to 1 L, and autoclave. 3. SOC media: Add 20 mL of sterile-filtered 1 Mglucose solution/L of the SOB media. 4. LB media: 10 g bacto-tryptone, 10 g NaCl, 5g yeast extract/L. Autoclave. Add tetracycline to 20 µg/mL. Check the genotype of the host bacteria for other drug resistance (e.g., streptomycin, kanamycin). If possible, a second antibiotic in addition to tetracycline should be added to the media and plates to help prevent contamination. 5. QIAquick PCR Purification and Nucleotide Removal Kits (Qiagen, Valencia, CA). 6. Wizard Plus Miniprep Kit (Promega, Madison, WI). 7. Electrocompetent bacteria of choice. The host bacteria must be pilus negative (F'-minus) and sensitive to the selectable antibiotic used (e.g., tetracycline in the case of fUSE5). Phage Libraries of Integrin-Binding Peptides 9 8. StrataClean Resin (Stratagene, La Jolla, CA). 9. LB agar plates with tetracycline (20 µg/mL). 10. Ethanol 100%. 11. 3 M NaOAc (pH 5.2), autoclave. 12. Glycogen solution, 20 mg/mL (Boehringer Mannheim, Germany). 13. SfiI and BglI restriction enzymes (New England Biolabs, Beverly, MA; Promega; or equivalent). 14. Sequenase Kit (Amersham, Arlington Heights, IL). 15. PEG/NaCl: 100 g of polyethylene glycol (PEG 8000), 116.9 g of NaCl, 475 mL double-distilled H O (ddH O). Rock in a 1-L bottle until solutes dissolve (it may 2 2 be necessary to heat to 65°C). This solution is stored at 4°C and it may be auto- claved. Final volume is 600 mL. 2.2. Coating Integrins on Microtiter Wells 1. Flat-bottom 96-well microtiter plates (Linbro/Titertek, ICN Biomedicals, Costa Mesa, CA). 2. Tris-buffered saline (TBS): 50 mMTris-HCl at pH 7.5, 100 mMNaCl, autoclave. 3. 25 mM n-octyl-(cid:96)-D-glucopyranoside (Calbiochem, La Jolla, CA) in TBS. This detergent keeps integrins solubilized. 4. TBS/1 mM MnCl . Mn+2 cations activate integrins and enhance the binding of 2 peptides to purified integrins. 2.3. In Vitro Panning 1. Phage display peptide library of choice. 2. Starved K91kan bacteria grown in TB/Kanamycin to OD = 1–2. 600 3. LB or NZY media containing tetracycline (20 µg/mL) and kanamycin (100 µg/mL). 4. Kanamycin/tetracycline LB agar plates. We adjust the concentration of kanamy- cin to 100 µg/mL and of tetracycline to 40 µg/mL. 5. PEG/NaCl solution (as described in Subheading 2.1.). 6. TBS/gelatin: 50 mMTris-HCl at pH 7.5, 150 mMNaCl. Autoclave 0.1 g of gela- tin in 100 mL of TBS. After autoclaving, swirl to dissolve the molten gelatin. Store at RT. 7. TBS, 3% BSA; TBS, 1% BSA. 8. TBS/0.5% Tween. 9. Elution buffer 1: 0.1 M glycine-HCl at pH 2.2/0.1% BSA/0.05% phenol red. 10. Elution buffer 2: 10 mM EDTA in TBS, 0.1% BSA. 11. Elution buffer 3: 500 µM GRGDSP synthetic peptide in TBS, 0.1% BSA. 2.4. Sequencing of Phage Insert 1. LB or NZY medium containing tetracycline and kanamycin (seeSubheading 2.3.). 2. PEG/NaCl (seeSubheading 2.1.). 3. StrataClean Resin (Stratagene). 4. Glycogen (Boehringer Mannheim). 5. 3 M NaOAc (pH 5.2). 10 Koivunen et al. 6. 70% Ethanol. 7. 100% Ethanol. 8. Primer for direct cycle-sequencing of phage ssDNA: 5' CCCTCATAGTTAGC GTAACG 3'. 9. Primers used when a double-stranded PCR product of the phage insert is prepared for sequencing: 5' TAATACGACTCACTATAGGGCAAGCTG ATAAACCGATACAATT 3' (sense) and 5' CCCTCATAGTTAGCGTAACGA TCT 3' (antisense). 10. Automated sequencing kit (ABI system, Perkin Elmer, Norwalk, CT) or conven- tional sequencing by the dideoxy method with a Sequenase kit (Amersham). 2.5. Cell-Adhesion Assay 1. Flat-bottom 96-well microtiter plates (Linbro/Titertek, ICN Biomedicals). 2. Microtiter plate reader (Technika Reader 520, Organon, Durham, NC or equivalent). 3. Extracellular matrix proteins (e.g., fibronectin, vitronectin, collagen). 4. TBS/3% BSA. 5. DMEM serum-free medium. 6. Integrin-expressing cell lines. 7. 2.5 mM EDTA. 8. Synthetic peptides to be tested: stock solutions up to 1 Mcan be made in ddH O 2 or DMSO, depending on the solubility of the peptide. Adjusting the pH may increase the solubility considerably. Use 1 MTris at the desirable pH (range will depend on the amino acid composition of the peptide). 9. 3.5% Paraformaldehyde/PBS. 10. 20% Methanol. 11. 5% Crystal violet. 12. 0.1% SDS. 3. Methods 3.1. Construction of Phage Display Peptide Libraries 3.1.1. Isolation and Purification of fUSE5 Vector The fUSE5 plasmid (5)is propagated in F'-minus host bacteria Escherichia coliMC1061. These bacteria should be grown in LB media (100 µg/mL strep- tomycin and 20 µg/mL tetracycline) (seeNotes 1and2). We recommend grow- ing at least a 1 L culture to obtain a reasonable working amount of this vector. fUSE5 is replication deficient and gives a low yield (5). A standard plasmid preparation protocol or a commercial plasmid purification kit (Qiagen, Promega, or Stratagene) may be used to isolate the plasmid. 3.1.2. Digestion of fUSE5 Vector The fUSE5 vector was engineered to contain a 14-bp “stuffer” that renders the phage noninfective by disrupting the gene III reading frame (5). Restora- Phage Libraries of Integrin-Binding Peptides 11 tion of infectivity occurs only when the stuffer is replaced by an in-frame insertion. The stuffer sequence of fUSE5 within gene III can be excised with the restriction enzyme SfiI. The overhanging ends left by the two SfiI sites are designed to be incompatible, leaving the vector unable to religate. This feature also allows for unidirectional cloning of a BglI DNA insert (4,5). It is recom- mended to use at least 30 µg of fUSE5 vector for the SfiI digestion because of losses during the purification steps. The SfiI-digested fUSE5 vector must be separated from the stuffer. A commercial kit (Qiagen, Promega, or Stratagene) may be used for this step. To confirm that the ~9.5-kb vector has been dilinearized, an aliquot may be run on an 0.8% agarose gel. Once fUSE5 diges- tion has been adequately obtained, the vector is ready for ligation. 3.1.3. Preparation of Insert The synthetic inserts are purchased or synthesized as single-stranded degen- erate oligonucleotides. The sequence of the template is: 5' CAC TCG GCC GAC GGG GCT (NNK) GGG GCC GCT GGG GCC GAA 3' X where N indicates an equimolar mixture of all four nucleotides; K indicates an equimolar mixture of G and T, preventing the introduction of a stop codon into the sequence. X represents the number of repeats. The oligonucleotide is con- verted into dsDNA using the Sequenase 4.0 Kit (Amersham). A complemen- tary primer at the 3' end of the template (5' TTCGGCCCCAGCGGCCCC 3') is used for the reaction. Next, the resulting reaction mixture is purified from any unbound primers and single-stranded oligonucleotides by using the QIAquick Nucleotide Removal Kit (Qiagen). Finally, the double-stranded oligonucleotide is digested with BglI. This produces overhanging ends that are compatible to those on the fUSE5 vector digested with SfiI. 3.1.4. Test Ligations Before the final ligation between the SfiI-digested fUSE5 vector and the BglI-digested insert is carried out, test ligations should be done to optimize the vector to insert molar ratio. Approximately 500 ng of vector is needed. A mock test ligation without adding the BglI insert fragment must be included as a negative control. To expedite the test, ligations may be carried out at room temperature for 3–4 h, then ethanol precipitated for at least 1 h at –20°C. The DNA pellet is then resuspended in 50 µL of ddH O. For the electroporation of 2 the host bacteria (F’-minus strain), use 1 µL of DNA solution and 25 µL of electrocompetent bacteria. Add samples to 1 mL of SOC media and shake at 225 rpm for 1 h at 37°C. Plate serial dilutions (e.g., 2 µL and 200 µL) on LB/ tetracycline plates. Count the number of colonies and determine the optimal vector-to-insert molar ratio, transformation efficiency, and background from the negative control ligation.