loading

Logout succeed

Logout succeed. See you again!

ebook img

In Search of Archaea among the Mat Layers of the Great PDF

pages17 Pages
release year2012
file size0.48 MB
languageEnglish

Preview In Search of Archaea among the Mat Layers of the Great

In Search ofArchaea among the Mat Layers of the Great Sippewissett Salt Marsh P.M. Fidopiastis, Mm-Ken Liao, Jorge L. M. Rodrigues, and Ana Isabel Anton Microbial Diversity, 1998 Abstract Microbial mats are stratifiedlayers ofdiverse microbial consortiathat generally consist ofa surface layer dominatedby cyanobacteriawith lower layers composedof purple anoxygenic phototrophic and sulfate reducing bacteria, among others. While the bacterial componenthas beenthe focus ofmost studies onmicrobial mat communities, the presenceand role ofarchaearemains largelyunstudied. Recentphylogenetic analyses have revealedthat archaeaareubiquitous, andthus, there is no apriorireason why archaeashould notbe presentinthe complexmicrobial assemblages ofthe mats. Our group took apolyphasic approachto determine ifarchaeaare presentinthe mat layers ofthe Great Sippewissett SaltMarshthatincluded: i) enrichment and isolation of methanogenic archaea, ii) F420autofluorescence (characteristic ofmethanogenic archaea) ofcells grown in enrichment cultures, iii) insituhybridization ofarchaea-specific DNA probes to cells grown inenrichmentcultures, and iv) sequence analysis ofarchael 16S rDNAthat was PCRamplifiedfrombothenrichmentcultures and directlyfromthe mat layers. After one week ofincubation at 22°C, bubble formation from in tactmat layers added to enrichmentmediawas our firstindicationthatmethanogenesiswas taking place. Cells from these enrichments autofluorescedwhen viewedby epi-fluorescence microscopy at420 nm andtheirDNA hybridizedto archaea-specific DNAprobes. The morphology ofthese cells (packets ofcoccoid cells) andtheirabilityto use methanol as a sole substrate for methanogenesis suggestedthatthey were members ofthe genus Methanosarcina. Sequence analysis ofthe single 16S rDNA RFLP type amplifiedfrom these enrichments suggestedthat an archeonmost closely related to Methanogenium was present. Archaeal 16S rDNA was also amplifieddirectly fromthe mat layers. At least 16 differentRFLP patterns were detected, suggesting that adiverse archael consortiummay bepresent. Sequence analysis ofthese cloned 16S rDNA genes is inprogress and will i) allowusto inferphylogeny ofthese archaea, ii) allowus to inferthe metabolic capabilities ofthese archaeabased ontheirphylogenetic grouping, and iii) will serve as a source ofarchael DNAforprobe designto study their ecology withinthemats. Introduction Microbial mats are stratifiedlayers ofcomplex microbial associations. The dominantprimaryproducers ofmats are the oxygenic photosynthesizing cyanobacteria. Common genera ofcyanobacteria found in mats are Nostoc,Anabaena, Oscillatoria, and Spirulina. Below the surface mat layer(s) are diverse assemblages of bacteriathat include members ofthe purple anoxygenic photosynthesizingbacteria and sulfate reducingbacteria; the latter can catabolize photosynthatein the presence ofsulfate (derived from seawateror other sources) to produce sulfide. Purple sulfurbacteria are in turn able to utilize the sulfide fortheirmetabolic needs. Cyanobacterial filaments produceextracellularmucopolysaccharide sheaths (fromphotosynthate) that give overall cohesion to the mat andprotect it from disintegration and drying during low tide cycles. Studies ofthese and other complex associations within the mat layers have focused largely on understanding the bacterial component ofthe mats, with little orno attention given to the presence androle ofarchaea. Our group took a polyphasic approach to determine ifarchaea are present in the mat layers that included: i) enrichment andpure culture isolation, ii) microscopy, iii) in situ hybridization using archaeaspecific DNA probes, and iv) sequence analysis of 16S rDNA. We emphasized the identification of methanogenic archaeaby enrichment andmicroscopybecause: i) they are responsible for C4H production in a variety ofanaerobic marine and freshwaterhabitats, yet their presencein microbial mat layers, to ourknowledge, is not documented, ii) they are relativelyeasy to detect due to theirmetabolic activity (4CH production), and iii) they possess aunique F420autofluorescence underepifluorescence microscopy. In situ hybridization using archael DNA probes and purification and sequencing of 16S rDNA from enrichment culture and mat samples were performedto provide a more comprehensive list ofarchaeathat arepresent. The specific goals ofthis project were to: i) detect the presence ofmethanogenic archaeathrough enrichment and subsequent isolation, ii) use epifluorescence microscopyto detect F420autofluorescence and fluorescence due to hybridization to labeled archael probes, and iii) extract, PCR amplify, clone, and sequence archaeal 16S rDNA from both enrichment cultures and directly from matlayers. Materials and Methods Samplingand Storage ofMatLayers Mat layer samples fromthe Great Sippewissett Salt Marsh were collected using a core sampler and eitherbroughtbackto the lab within 3 h ofcollection orwere inoculated directly into enrichment cultures. Unusedmats were stored at4°C for upto two weeks in casethey were needed for further analyses. Individual mat layers (green, pink, black, and gray) were separatedusing arazorblade. Enrichmentfor Methanogenic Archaea Mat layer samples were directly inoculated into anaerobicBasic SaltwaterMedium that was reduced byN2Sa and supplemented with 10mM methanol (according to the recipe of B. Schirik). Enrichmentcultures were incubated at 22°C inthe dark forup to 2 weeks. Due to alackoftime, agar shakes to isolate methanogenswere notperformed. Genomic DNA Extraction Genomic DNA from 1 g ofeach mat layer and 0.5 g ofsediment from a single enrichmentculture containing all mat layers was extracted according to the procedure providedinthe course handout. The only modificationwas that following the extraction procedure, DNA was purifiedusing the Wizard DNA PurificationKit (Promega Corp.) according to manufacturer’s specifications. Concentration ofextracted DNAwas estimatedusing the DNADipstickKit (Invitrogen Corp.). Materials and Methods cont. PCRAmplification To determine ifthe purifiedDNA contained any inhibitors ofthe PCRreaction, purified DNA was mixed withuniversal forward (5’ AGAGTTGATYMTGGC 3’) and reverse (5’GYTACCTTGTTACGACTT 3’) 16S rDNAprimers andthese PCRreactions were performed (according to the methods outlined inthe course handout) priorto running PCRreactions using the more specific archael primers. To amplify archael 16S rDNA, two forward archael primers were used separatelywiththe universal reverseprimer. The forwardarchael primers were: AF1 (5’ TCCGGTDGATCCTGCCRG 3’) and AF21 (5’ TCCGGTTGATCCYGCCGGA 3’). PCRreactions containing 0.025 to 0.05 ng of purified DNA, 2.0 mM M2gCl and 0.5 j.il (per 50 j.fl reaction) ofAmpliTaq Gold DNA polymerasewere cycledunderthe following conditions: 94°C, 5 mm. (hot start), followed by 35 cycles of94°C for2 mm, 63°C for 1 mm, and 72°C for 2 mm, with afinal extension of72°C for 10 mm. Cloning and R1?LP Analysis ofPCRProducts PCRproducts were cloned into the PCRIIplasmid (Invitrogen Corp.) according to manufacturer’s specifications. Colonies ofpotential transformants were individually spotted onto anLB-ampicillin (100 pg/mi) plate (for storage followingtheir growth) and then immediately addedto separate PCRreactions which were mixed with TOPO forward andreverseprimers (TOPO TA Cloning Kit, Invitrogen Corp) in orderto amplify (andthus detect) the presence ofthe insert. PCRproducts fromthese reactions Materials and Methods cont. Cloning and RFLP Analysis ofPCRProducts cont. were thenmixed withHinPI andMspI (accordingto the coursehandout) and the resulting restrictionpatterns were analyzedby agarose gel electrophoresis. PCRproducts yielding uniquerestrictionpatterns were either sent out immediately for sequencing or frozen for future analyses; those PCRproducts sent outfor sequencingwere submittedto the BLAST database. In Situ Hybridization and MicroscopicAnalysis Cells from methanogenenrichmentcultures were concentrated by centrifugation and either viewed by epifluorescencemicroscopy for F420autofluorescence orwereprepared forFluorescentIn-SituHybridizationusingthe archael DNAprobe ARCH (5’ GTGCTCCCCCGCCAATTCCT 3’) and DAPI counterstain accordingto the course handoutprepared by S. Dawson. Results Evidence for Methanogenesis in Mat LayerEnrichments After 1 week ofincubation, bubble formation suggestedthatmethanogenesis was taking place inthe enrichment cultures. Formation ofbubbles (presumably methane) subsequentlyincreased duringthe secondweek ofincubation. Extraction, Purification, PCRAmplification, Cloning, and RFLP Analysis of Archael 16S rDNA from Three ofFourMat layers and One Enrichment Culture DNA isolated fromboth enrichment culture and directly fromthe fourmat layers was initially brown in color suggesting thathumics and other contaminants were presentin the samples. Such DNA, whenused inPCRreaction, wouldnot amplify without further purificationby passage through WizardDNAKit columns. In general, dilutions ofup to 1:100 ofthe extractedDNA were also necessaryto achieve optimal amplification. The additionofuniversal forward and reverse primers to PCRreactions yieldedproducts of the appropriate size (1.5 kb) from all mat layers, however, we were initially unsuccessful at amplifying 16S rDNAusing archaelprimers with all other conditions the same as those used for amplification withthe universal primers. Afterrepeated optimization steps usingthe Invitrogen PCR OptimizerKit (accordingto manufacturer’s specifications), an optimized scheme was devisedfor amplifying archael DNA from at least one layer (using Buffer B containing 2.0 mM M2,gC1 (pH 8.5) ofthe optimizer kit, 63°C primer annealing, andvarious dilutions ofDNA ofupto 1:100; datanot shown). RFLP analysis ofthese PCRproducts revealedthat at least 3 differentrestrictionpatterns were present. Interestingly, no amplification ofany otherlayerwas achieved using these optimized conditions. However, whenAmplitaq GoldPolymerase (Perkin-Elmer Corp.) was used inplace ofTaq Beads, combined withthe PCRprotocol fromthe course handout, Results cont. Extraction,Purification,PCRAmplification, Cloning, and RFLP Analysis of Archael 16S rDNA from Three ofFour Mat layers and One Enrichment Culture cont. we were able to amplifr archael DNA from boththe gray and blackmatlayers (Fig. 1) as well asfromenrichmentculture, but not fromthepinkor greenlayers (datanot shown). Subsequently, analiquot ofpink layer DNAwas analyzed by agarose gel electrophoresis and appearedto be degraded. Fromtwo separateplates containing over 100 potential 16S rDNA insert-containing clonesfromboth gray andblack layerDNA samples, 20 were selected (10 fromcloning reactions fromeach layer) for RFLP analysis. At least 14 differentrestrictionpatterns wererepresented inthese samples (5 fromthe gray layer and 9 fromthe black layer; Fig. 2). A single RFLP patternwas achieved fromthe 16S rDNA amplifiedfrom enrichmentculture and its sequence wasmost closelyrelatedto the archael genusMethanogenium (Fig. 3). F429Autofluorescence andIn Situ Hybridization Revealed the Presence ofArchaea in Enrichment Cultures. F420 autofluorescence was detected in concentrated samples ofmethanogen enrichment cultures (Fig. 4), butwas not detectedin any mat layer directly. However, due to the large number ofmicrobes in atypical mat layer sample (Fig. 6) the lesser abundant methanogens can easily be missed. The cells appearedto be coccoidin shape and arranged aspackets ofcells (Figs. 5a-b). Similarly, these cells hybridizedto archaea specific DNAprobes (Fig. 5b). Theirmorphology and abilityto utilize methanol as a sole substrate formethanogenesis suggests thatthey are members ofthe genus Methanosarcina. Interestingly, DNA ofa filamentousbacterium (Fig. 7b) also reacted withthe archaeal probe supporting the possibilitythata diverse archael population may occurinthe mat layers. Discussion The results ofour researchprovide evidence forthe occurrence ofapotentially diverse populationofarchaeawithinthe mat layers ofthe Great Sippewissett SaltMarsh. 16S rDNARFLP patterns suggestthat at least 17 uniquephylogenetic types ofarchaea are presentinthree ofthe mat layers (pink, black, and gray). Sequencing ofthese 16S rDNAs will be required in orderto more accurately infertheirphylogenies. Based on phenotypic data(metabolic andmorphological) there is evidence to supportthat Methanosarcinamay bepresentinthe enrichmentcultures, whereasphylogenetic analysis ofthe sole 16S rDNA clone suggests thatthe predominant archeonwithin the enrichments is most closelyrelated to Methanogenium. Takentogether, these data provide strong evidence to supportthat archaea arepresent inthe mat layers. Inthe future, in order to isolatethese methanogens and more accurately identifr them, cultures shouldbe started earlier. Interestingly, the potential archeonpictured in Fig 7b appears to be morphologically identical to an archeon from sulfide-rich sediment fromthe great Sippewissett Salt Marsh detectedby S. Dawsonin 1997. In conclusion, we have provided datafulfilling each ofour goals as listed inthe introduction and expectthatthis workwill: i) provide the first additions to what shouldbe a growing list ofarchaeal 16S rDNA sequences from the mat layers, ii) facilitate more detailed future studies onthe phylogeny (and thus, metabolic capabilities) ofarchaeainthe mat layers, and iii) facilitate probe design for ecological studies ofthese and other archaea. FigureLegends Fig. 1. PCRamplification of16S rDNA usingarchaelforward primerAF1 and universal reverse primer. Lanes2-11: Blacklayer(top gel); Lanes 12-14 GrayLayer(top gel); Lanes2-7: Graylayer (bottom gel) Fig. 2. RFLPpatterns ofthePCRproductsfrom Fig. 1. First 10ofthe“Pat” lanes: BlackLayer; Last 10of“Pat” lanes: Gray layer Fig.3. Phylogenetictreeconstructed using sequence data from thesingle 16S rDNA clonefrom enrichmentculture Fig. 4. F420autofluorescence ofcells from enrichmentculture Fig. 5a. DAPI-stained cellsfrom enrichment culture Fig. 5b. HybridizationofDNAfrom cells inenrichmentculturetoan archaea-specificDNAprobe Fig. 6. An exampleofthe morphologicaldiversityofcellswithin the pinkmatlayer Fig. 7a. DAPI-stained filamentous prokaryotefrom enrichmentculture Fig. 7b. Hybridization ofDNAfrom the filamentousbacterium in 7ato an archaea-specificDNA probe AppendixI Checkerboard hybridization onDIG-labeled PCRproducts from four layers ofthe microbial mat

See more

The list of books you might like