Logout succeed
Logout succeed. See you again!
Hematopoietic Stem Cell Protocols PDF
Preview Hematopoietic Stem Cell Protocols
M E T H O D S I N M O L E C U L A R M E D I C I N ETM HHeemmaattooppooiieettiicc SStteemm CCeellll PPrroottooccoollss EEddiitteedd bbyy CChhrriissttoopphheerr AA.. KKlluugg CCrraaiigg TT.. JJoorrddaann HHuummaannaa PPrreessss AGM and Yolk Sac HSC 1 1 Isolation and Analysis of Hematopoietic Stem Cells from Mouse Embryos Elaine Dzierzak and Marella de Bruijn 1. Introduction Recently, there has been much interest in the embryonic origins of the adult hematopoietic system in mammals (1). The controversy surrounding the potency and function of hematopoietic cells produced by the yolk sac com- pared to those produced by the intrabody portion of the mouse embryo has prompted much new research in the field of developmental hematopoiesis (2–8). While the yolk sac is the first tissue in the mammalian conceptus to visibly exhibit hematopoietic cells, the intrabody region—which at different stages of development includes the splanchnopleural mesoderm, para-aortic splanchnopleura (PAS) and the aorta-gonad-mesonephros (AGM) region— clearly contains more potent undifferentiated hematopoietic progenitors and stem cells before the yolk sac. Furthermore, the most interesting dichotomy revealed by these studies is that terminally differentiated hematopoietic cells can be produced in the mouse embryo before the appearance of cells with adult repopulating capacity. Thus, the accepted view of the adult hematopoietic hier- archy with the hematopoietic stem cell (HSC) at its foundation does not reflect the hematopoietic hierarchy in the developing mouse embryo (9). Because this field offers many questions concerning the types of hematopoietic cells present in the embryo, the lineage relationships between these cells, and the molecular programs necessary for the development of the embryonic and adult hemato- poietic systems, this section presents the approaches taken and the materials and methods necessary to explore the mouse embryo for the presence of the first adult repopulating HSCs. From: Methods in Molecular Medicine, vol. 63: Hematopoietic Stem Cell Protocols Edited by: C. A. Klug and C. T. Jordan © Humana Press Inc., Totowa, NJ 1 2 Dzierzak and de Bruijn 2. Materials 2.1. Isolation and Dissection of Embryonic Tissues 1. Dissection needles: sharpened tungsten wire of 0.375-mm diameter (Agar Scien- tific Ltd.) attached to metal holders typically used for bacterial culture inocula- tion. 2. Dissection microscope: any suitable dissection microscope with magnification range from ×7–40 with a black background stage and cold light source. 3. Culture plates: 60 × 15 mm plastic tissue culture dishes. 4. Medium: phosphate-buffered saline (PBS) with 10% fetal calf serum (FCS), peni- cillin (100 U/mL) and streptomycin (100 µg/mL). 2.2. Organ Explant Culture 1. Millipore 0.65 µm DV Durapore membrane filters: Before use, filters are washed and sterilized in several changes of boiling tissue-culture water (Sigma, cat. #W- 3500) and dried in a tissue-culture hood. 2. Stainless-steel mesh supports: Supports were custom-made in our workshop by bending a 22 mm × 12 mm rectangular piece of stainless-steel wire mesh so that it stands 5 mm high with a 12 mm × 12 mm supportive platform. Supports are washed in nitric acid (HNO for 2–24 h, then rinsed five times in sterile milliQ 3) water. Subsequently, they are sterilized in 70% ethanol and rinsed two times in tissue-culture water (Sigma). Then, the supports are dried in a tissue-culture hood. 3. 6-Well tissue culture plates. 4. Curved fine point forceps. 5. Medium: Myeloid long-term culture (LTC) media (M5300, StemCell Technolo- gies). Supplemented with hydrocortisone succinate (Sigma), 10–5 M final con- centration. 6. Scalpel blade. 2.3.1. Preparation of a Single-Cell Suspension from Dissected Embryonic Tissues 1. Collagenase Type I (Sigma): Make a 2.5% stock solution in PBS and freeze aliquots at –20oC. For use, make a 1:20 dilution of stock collagenase in PBS-10% FCS-Pen-Strep. One mL of 0.12% collagenase will disperse approx 10 embry- onic tissues when incubated at 37oC for 1 h. 2.4.1. PREPARATIONAND STAININGOF SINGLE-CELL SUSPENSION 1. Propidium iodide (Sigma). 2. Heat-inactivated FCS. 3. Hematopoietic-specific antibodies, available from sources such as Pharmingen. AGM and Yolk Sac HSC 3 2.5.1. Colony-Forming Unit-Spleen (CFU-S) Assay 1. Tellyesniczky’s solution: for 100 mL, mix 90 mL of 70% ethanol, 5 mL of gla- cial acetic acid, and 5 mL of 37% formaldehyde (100% formalin). 2.5.2.1. PERIPHERAL BLOOD DNA PREPARATIONAND PCR ANALYSIS 1. Blood Mix: 0.05 M Tris-HCl pH 7.8, 0.1 M EDTA, 0.1 M NaCl, 1% SDS, 0.3 mg/ mL Proteinase K. 2. RNase A: 10 mg/mL stock solution. 3. Phenol-Chloroform-Isoamyl alcohol. 4. 2 M sodium acetate (pH 5.6). 5. Isopropanol. 6. 70% ethanol. 7. LacZ PCR primers: lacz1 5’GCGACTTCCAGTTCAACATC3' lacz2 5’GATGAGTTTGGACAAACCAC3' 8. YMT2 PCR primers: ymt1 5’CTGGAGCTCTACAGTGATGA3' ymt2 5’CAGTTACCAATCAACACATCAC3' 9. Myogenin PCR primers: myo1 5’TTACGTCCATCGTGGACAGC3' myo2 5’TGGGCTGGGTGTTAGTCTTA3' 10. Deoxynucleotide 5' triphosphate (dNTP) mix: stock solution of 10 mM each of deoxyadenosine 5' triphosphate (dATP), deoxythymidine 5' triphosphate (dTTP), deoxyguanosine 5' triphosphate (dGTP), deoxycytidine 5' triphosphate (dCTP). 11. PCR (10X) mix: 100 mM Tris-HCl, pH 9.0, 15 mM MgCl , 500 mM KCl, 1% 2 Triton-X-100, 0.1% w/v stabilizer. 12. Taq polymerase. 2.5.2.2. MULTILINEAGE ANALYSIS 1. Complete medium: RPMI-1640, 5% FCS, 2 mM L-glutamine, 10 mM HEPES, 100 U/mL penicillin, 100 µg/mL streptomycin, and 100 µM 2-mercaptoethanol. 2. Lipopolysaccharide (Sigma). 3. Murine interleukin 2 (IL-2)(Biosource) 4. Concanavalin A (Sigma). 5. L-cell conditioned medium. 6. Lineage-specific antibodies are routinely used (available from sources such as Pharmingen). 3. Methods 3.1. Isolation and Dissection of Embryonic Tissues 1. To obtain embryonic tissues for the analysis of HSCs and progenitors, adult male mice are mated with two females in the late afternoon. Females are checked for the presence of a vaginal plug the following morning. If a plug is found, this is considered embryonic d 0 (E0) (seeNote 1). 4 Dzierzak and de Bruijn Fig. 1. Schematic diagram of the dissection procedure on an E10/E11 mouse em- bryo. Dark broken lines show the regions in which a series of cuts are performed on the mouse embryo. (A) The yolk sac (YS) is removed by cutting the vitelline artery (VA) and umbilical artery (UA) the site where they join the yolk sac. A second cut adjacent to the embryo body frees the arteries. (B) The dissection needles cut the head and tail regions from the trunk of the embryo which contains the AGM and liver (L). (C) The internal organs (gastrointestinal tract, heart, and liver) are dissected away first, and then the dorsal tissues (the neural tube and somites) are removed. (D) After turning the remaining trunkal region of the embryo so that the ventral side is facing upwards, the dissection needles are inserted under the AGM region, and the remaining somitic tissue is dissected away. 2. Pregnant females at the chosen day of gestation are sacrificed, and uteri removed into a 60 × 15 mm tissue-culture dish containing PBS-FCS (PBS with 10% FCS, penicillin 100 U/mL and streptomycin 100 µg/mL). 3. Using a dissection microscope (×7–8 magnification) and fine forceps or scissors, remove the muscular wall of uterus from the individual decidua. Then with small grasps of the forceps, remove Reichert’s membrane, which is the thin tissue layer surrounding the yolk sac (13). During these manipulations, the embryos are trans- ferred to other culture dishes containing PBS-FCS to wash away maternal blood contamination. AGM and Yolk Sac HSC 5 4. The yolk sac is isolated by grasping with the fine-tipped forceps and tearing open this tissue which surrounds the embryo. The yolk sac is torn off at the blood vessels (vitelline and umbilical vessels) which connect it to the embryo proper (Fig. 1A). The embryo is now covered only by a very thin amnionic sac that may have been broken during the dissection. The vitelline and umbilical arteries may now be obtained with fine scissors by cutting them off at the connection to the embryo body proper (for staging of embryos, seeNote 2). 5. For the dissection of fetal liver and the AGM region from the embryo proper, we switch to the use of dissection needles and a slightly higher magnification. Dis- section needles are made from small pieces of sharpened tungsten wire attached to metal holders, which are typically used for bacterial culture inoculation. A sharpening stone, normally used to sharpen knives, is used to produce a fine point at the tip of the tungsten wire. One needle is generally used to hold the embryo in the area where cutting is desired. The other needle is slowly moved alongside the holding needle in a cutting action. Only small precise areas are dissected with each needle placement. 6. Briefly, to dissect an E10/E11 embryo as it is lying on its side, the dissection needles are used to cut the trunk of the embryo from the tail and head (seeFig. 1B). The needles are then used to remove the lung buds, heart, liver and gas- trointestinal (GI) tract from the embryo. The liver can then be dissected cleanly from the heart, GI tract, and remaining connective tissue (Fig. 1C). 7. Next the somites and neural tube, running along the dorsal side of the embryo, are removed with care to maintain the integrity of the dorsal aorta (Fig. 1C). The trunk of the embryo is now adjusted so the ventral side is facing upwards. The AGM region is now clearly visible. The remaining somites can be cut away by inserting the needles under the AGM (Fig. 1D). 3.2. Organ Explant Culture An organ explant culture has been developed to examine the growth of colony-forming units-spleen (CFU-S) and long-term repopulating hematopoi- etic stem cells (LTR-HSC) in individual embryonic tissues (5). Beginning at E8.5 (9 somite-pair stage), the circulation between the mouse embryo body and the yolk sac is established (6). Thus, in vitro culture of explanted tissues allows for the analysis of these tissues in an isolated manner, preventing cellu- lar exchange. The culture method was optimized for the maintenance/produc- tion of CFU-S and LTR-HSC by placing the dissected tissues at the air/medium interface in the culture rather than submerging them in medium. No exogenous hematopoietic growth factors are added; thus the CFU-S and HSC rely only on the endogenous signals provided by the embryonic tissue. 3.2.1. Culture Procedure 1. One wire mesh support is placed into each well of a 6-well culture plate, and the wells are filled with 5 mL of medium. 6 Dzierzak and de Bruijn 2. With forceps, a filter is placed onto the mesh support and allowed to become permeated with medium. The medium level should be adjusted so that the filter is at the air-medium interface. 3. Individual dissected embryonic tissues are placed on the filters, using curved forceps. Up to six individual tissues can be cultured per filter. Empty wells of the culture plate are filled with PBS or sterile water (to maintain humidity), and the culture plate is carefully placed in a 37o, 5% CO incubator. Tissue explants are 2 cultured for 2–3 d. 3.2.2. Harvest of Cultured Tissues 1. Using forceps and gloved hands, the filter holding explanted tissues is removed from the culture plate. The filter is held in one hand, while a scalpel blade is used to scrape each tissue individually from the surface of the filter. 3.3. Transplantation of Embryonic Hematopoietic Cells into Adult Recipients In vivo transplantation assays have long been established for the purpose of examining cell populations for the presence of HSCs or progenitors (16). In measuring the hematopoietic capacity of embryonic tissues, we have used both the short-term CFU-S assay (3,5,17) and the LTR-HSC assay (5,10,11). While the frequency of CFU-S and LTR-HSCs is a useful measurement for adult bone-marrow populations, since these cells are in limited numbers within an individual embryo, pools of embryo-derived cells are typically used in trans- plantation assays. Thus, after staging mouse embryos from the available litters by counting somite pairs, only embryos within a desired developmental win- dow are used (for example, from late E10, we would pool embryos of 36–40 somite pairs [sp]). The embryos are dissected and a single-cell suspension is prepared from the pooled tissues, noting the number of tissue embryo equiva- lents. It is thus possible to determine the absolute numbers of CFU-S and re- populating units in an individual embryo within a temporal context at the earliest stages of development. 3.3.1. Cell Preparation 1. Collagenase treatment is performed to obtain a single-cell suspension from dis- sected embryonic tissues or from explant cultures of embryonic tissues. Tissues are placed into 1.0 mL of 0.12% collagenase in PBS-FCS-Pen-Strep and incu- bated at 37oC for 1 h. During the incubation, the tube is occasionally tapped to aid the dispersion of the tissue. 2. After incubation, the tube is placed on ice. Five mL of PBS-10% FCS is added to the cells and using a blunt-ended pipet held against the bottom of the test tube, the tissue suspension is pipetted back and forth up to 20 times to disperse the cells. Cells are centrifuged at 250g and washed two times. AGM and Yolk Sac HSC 7 Table 1 Number of Viable Cells Obtained from Mouse Embryonic Tissues after Collagenase Treatment Cell number (× 104) per tissue Embryonic Somite day pairs PAS/AGM Yolk sac E9 20–29 8.4 +/– 3.8 12.5 +/– 4.8 E10 30–39 12.0 +/–3.5 20.1 +/– 6.9 E11 >40 21.2 +/– 6.2 47.1 +/– 3.8 3. Viable cell counts are performed using Trypan blue dye exclusion. After collage- nase treatment, it is expected that only approx 50–75% of the embryonic cells will be viable. Table 1 provides a summary of the expected number of viable cells that can be obtained from the PAS/AGM and yolk sac from E9, E10, and E11 embryos after collagenase treatment. 4. For immediate in vivo injection, the desired number of cells or known embryo equivalents of cells are suspended in PBS (0.2 mL–0.5 mL per recipient). If some time will elapse before injection, cells are suspended in PBS with 10% FCS, and later washed and resuspended in PBS alone. All cell suspensions are kept on ice. 5. To promote the survival of the irradiated recipient mice so that the engraftment properties of hematopoietic cells from embryonic tissues can be measured, we typically cotransplant a small number of normal unmarked (recipient-type) adult spleen cells (2×105) into each recipient along with the marked test cells (10,11). These cells are included in the volume (0.2–0.5 mL) to be injected intravenously into the lateral tail vein. Also, competitive transplantation strategies with un- marked HSCs (18) can be used to test for the quality of the donor-marked he- matopoietic cells. 3.3.2. Transplantation Protocol Male or female (nontransgenic) 2–3-mo-old mice can be used as recipients for donor embryonic cells in CFU-S or LTR-HSC assays. When using the Y chromosome as the genetic marker for donor embryonic cells, female recipi- ents of the same strain are required. As in all transplantation protocols, the use of a transgene marker in donor embryonic cells requires the use of either male or female nontransgenic recipients of the same strain as the donor transgenic. We have used inbred strains (C57BL/6, C57BL/10) and F1 strain combina- tions ([CBA × C57BL/10]F1, [129 × C57BL/6]F1) as recipients in our trans- plantation experiments. 1. The mice designated for transplantation experiments are housed in filter-top microisolator cages which eliminate the possibility of viral infection within the colony. Before transplantation, recipients are maintained on 0.037% HCl water (3.7% stock diluted 1:100) for at least 2 wk. 8 Dzierzak and de Bruijn 2. On the day of transplantation, recipients are irradiated with a split dose of 9 gy for LTR-HSC and 10 gy for CFU-S from a gamma radiation source. The first dose of 4.5–5 gy is given 3 h before the second dose of 4.5–5 gy. The dose of irradiation should be tested within each facility, because variation in the lethal dose of gamma sources and in the strains of mice have been observed. 3. Prior to injection, adult mice are warmed briefly under a heating lamp to dilate the blood vessels and restrained in a holder through which the tail can be threaded. The tail is cleaned with 70% ethanol to make visible the veins lateral to the dor- sal-lateral tail artery. 4. Injection of 0.2–0.5 mL (per recipient) into the lateral tail vein is performed us- ing a 1-mL tuberculin syringe and 25–26-gauge needle. Thereafter, mice are maintained on antibiotic water containing 0.16% neomycin sulfate (Sigma) for at least 4 wk. 3.4. Flow Cytometric Analysis/Sorting of Cells from Embryonic Tissues The cell-surface marker characterization of functional HSCs and the pro- genitors within the developing mouse conceptus pose special problems in iso- lation, viability, and analysis. As discussed in previous sections, the numbers of cells isolated from the hematopoietic tissues of early-stage embryos are lim- ited. For phenotypic analysis only, without any functional transplantation, only a few embryos are required. However, several litters of embryos must be iso- lated and dissected on the same day when functional cells are to be sorted fluorescence-activated cell-sorting (FACS). For example, a good cell-sorting experiment using two different antibodies for the isolation of cells to be trans- planted in limiting dilution into adult recipients requires approx 20–40 AGM regions from marked E11 embryos (11). Studies such as these require team- work, allowing the rapid dissection of embryos by several researchers simulta- neously. 3.4.1. Preparation, and Staining of Single-Cell Suspension 1. Embryonic tissues are collagenase-treated as described in subheading 3.3.1, steps 1–3. After washing, the cells are suspended in PBS with 10% heat-inacti- vated FCS. 2. Incubation with CD16/CD32 (2.4G2) monoclonal antibody (MAb) (anti-FcRII and III, Pharmingen) is performed for 20 min on ice to lower nonspecific staining. 3. This is followed by incubation with antibodies of interest (for example, CD34- biotin and c-kit-Fluorescein-5 isothiocyanate (FITC), Pharmingen) for 20–30 min on ice. Cells are then washed twice in PBS with 10% FCS and Pen-Strep and subsequently incubated with fluorochrome-conjugated streptavidin when required. AGM and Yolk Sac HSC 9 Fig. 2. FACScan plots for forward-scatter and side-scatter of AGM, yolk sac, and fetal liver cells from E11 mouse embryos. Debris and dead cells (based on PI staining) are gated out. The number of cells analyzed per sample is 1.5 × 104. 4. Again, labeled cells are washed twice and filtered through a 40-µm nylon mesh screen (Falcon) to remove cell clumps. After washing, cells are resuspended in PBS with 10% FCS containing 0.5 µg/mL propidium iodide (PI, Sigma) (11). 3.4.2. Sorting 1. Viable cells are defined by exclusion of PI-positive and high obtuse scatter or low forward scatter on a FACStar Plus or Vantage cell sorter (Becton-Dickinson) or any other appropriate cell sorter. Fig. 2 shows forward-scatter and side-scatter FACScan plots of AGM, fetal liver and yolk sac cells from E11 embryos. Vary- ing distributions of the cells from each of these tissues on the basis of size and granularity are observed after gating out dead cells (PI positive) and debris. 2. Collection gates for marker-positive cells are set by comparison to cells stained with fluorochrome-conjugated immunoglobin isotype controls (11). Viable fluo- rescent positive cells are collected and reanalyzed for purity and counted. 3. For functional transplantation assays, sorted cells are suspended in PBS at the desired cell number or embryo equivalent for injection as described in Subhead- ing 3.3.1., step 4. We have obtained the best results on cells transplanted as soon as possible after the sorting procedure (this is about 8 h after starting the dissec- tion of the embryos). 3.5. Analysis of Transplanted Adult Mice 3.5.1. CFU-S Assay 1. To determine the CFU-S content of embryonic tissues, tissues are collagenase- 11 treated as described in Subheading 3.3.1., step 1 and cells are injected into the tail vein of lethally irradiated (10 gy) mice (3,5,17). Control irradiated mice that do not receive cells should be included in each experiment, to check for residual endogenous spleen-colony formation.

