Logout succeed
Logout succeed. See you again!

Genetic and Morphometric Characterization of Mussels (Bivalvia: Mytilidae) From Mid-Atlantic Hydrothermal Vents PDF
Preview Genetic and Morphometric Characterization of Mussels (Bivalvia: Mytilidae) From Mid-Atlantic Hydrothermal Vents
Reference: Bid. Hull. 1%: 265-272. (June I9W) Genetic and Morphometric Characterization of Mussels From Mid-Atlantic (Bivalvia: Mytilidae) Vents Hydrothermal PAULA A. Y. MAAS*. GREGORY D. O'MULLAN, RICHARD A. LUTZ, AND ROBERT C. VRIJENHOEK Centerfor Theoretical andApplied Genetics and Institute ofMarine and Coastal Sciences, Rutgers University, New Brunswick, New Jersey 08901 Abstract. Mussels were collected from deep-sea hydro- were described from hydrocarbon seeps in the Gulf of COM thermal vents along the Mid-Atlantic Ridge. Specimens Mexico (GOM) (Gustafson et /., 1998). The new from the Snake Pit site were previously identified geneti- species were first identified in an allozyme study aimed at cally and anatomically as Bathymodiolus puteoserpentis, describing genetic diversity in these mytilids (Craddock et but the relationships ofmussels from other sites (Logatchev til., 1995a). This study also recognized two genetically and Lucky Strike) were unclear. Molecular genetic and distinct populations ofmussels from the Mid-Atlantic Ridge morphological techniques were used to assess differences (MAR; Fig. 1). The degree ofdivergence between mussels among these mussel populations. The results indicate that from the Snake Pit (2322'N) and Lucky Strike (3717'N) the range for B. puteoserpentis extends from Snake Pit to localities (Nei's D = 1.179) led the authors to suggest that Logatchev, and that an unnamed second species, B.NnA. DspH., two distinct species occupied the MAR. Von Cosel and occurs at Lucky Strike. Analysis of mitochondria] coworkers (1994) described the mussels from Snake Pit as dehydrogenase subunit 4 (ND4) revealed 13% sequence a new species, Bathymodiolus puteoserpentis. On the basis d(iDv)erbgaesnecdeobnet1w4eeanlltohezytmweolsopceiciweass. N0e.i1'1s2.geAnetmiucltdiivsatrainactee othfamtomrupshsoellosgifcraolmcoLmupcakryisSotnrsi,kethsehyosuulbdsebqeuernetcloygnsiuzgegdesatseda tfmouonrscpptheiocoimneestthra9ti5cc%oraronefaclttylhsyeisitdiemyneit.eilfdieeddinadicvaindounailscaflrodmistchreismeisniatnets duMinsAntiRanmctesdpsepce(civieoesns,aCsboustBe.ltone.dtatspe/..,thf1eo9rL97ut)ch.ekyWpreSetsrreienkfetermpuutsrospetohlsesessr.eemcVaooinnnd Introduction Cosel et al. (1997, p. 146) also suggested that mussels from the southernmost MAR locality (Logatchev; 1445'N) "be- Modioliform mussels that depend wholly or in part on long to another new species, which is however extremely symbiotic bacteria for their nutriment are common constit- close to B. puteoserpentis . . . only an electrophoretic anal- uents of biological communities associated with deep-sea ysis could determine the distance between this new (e.g., hydrothermal vents and cold-water sulfide/hydrocarbon Logatchev) species and B. puteoserpentis." seeps throughout the world. Eight species of these mussels The purpose of this study was to clarify evolutionary were known to occur in vent and seep environments in the relationships among these MAR mussels. We examined Atlantic and Pacific Oceans (Desbruyeres and Segonzac, mitochondria! DNA sequences and allozyme variation in 1997). Recently, five new species, including one new genus. new samples collected from Lucky Strike, Snake Pit, and We Logatchev during July 1997 (Fig. 1; Table 1). clearly Received 30 November 1998; accepted 9 March 1999. show that the Logatchev population and B. puteoserpentis Jamenarda*sseT@Ayoap,ep7wsl1oihpeDo.dumrduGletcengoyeertrrRiseoc.ssaep,ddo.unRdNoeeonwcmeB3sr1hu8on.uslwRdiucbtkge.eraNsd,derwetshJeseerdSs.teayCtee0n8Ut9ne0irv1ef-ro8rs5i2Tth1ye.ooErf-emtNaiicelaw:l adbiresettwigneecententsiptcehcaeileltsyw.oiIdnkennatdoidwciantlioManin,dd-wAedtolcalnnaortitifcywaRtrhiredaggneetnesspteeipccairedsai.tsitoannceass 265 266 P. A. Y. MAAS ET AL EDTA) to a finalconcentration of 100-500ng/jul andstored for short periods at 4C and for longer periods at 20C. An approximately 710-bp region ofthe mitochondriawas MenezGwen Oceanographer / amplified using primers designed to amplify ND4-L in fish. F.Z. -- 1-LuckyStrike Arg BL (5'-CAA gAC CCTTgATTTCgg CTC A-3') is in AtlantisF.Z.- ./ Rainbow the tRNA arginine (Bielawski andGold, 1996) andNAP 2H BrokenSpur (5'-Tgg AgC TTC TAC gig A/ggC TTT-3') is within KaneF.Z. -.. A~ TAG ND4 itself(Arevalo etal., 1994). Comparison ofthe result- SnakePit ing sequences via BLASTN (Altschul et ai, 1990) and -/_v_-_._-_- Logatchev BLASTP (Altschul et al., 1997) searches of GenBank se- quences indicated that these primers amplified tRNA-Met, tRNA-Val, andthe first thirdofND4 inBathymodiolus. The ,60w o 50-ju.l amplification reaction contained 100-500 ng tem- Figure 1. Geographic locations of Bathymodiolus collection sites plate DNA. 2.5 mM MgCK. 20 p.M dNTP (5 pM each along the Mid-Atlantic Ridge. Major fracture zones (F.Z.) are shown. nucleotide), 0.4 ju,/W of each primer, 1.5 units Taq poly- merase, and 5 jul 10X buffer (Promega, Madison, WI). The polymerase chain reaction (PCR) profile (95C/45s, Materials and Methods 56C/45s, 72C/min) continued for35 cycles, with an initial Specimens denaturation at 95C/2 min and a final extension at 72C/7 min. Negative controls were included with each set of Using the deep submergence vehicle Alvin's mechanical MAR amplifications. cI)laiwn,Juslaymp1l9e9s7.weOrnececoalbloecatre4ddCtahleosnugptphoert vessel(FAitgl.an1t.isT,abwlee viePwCeRd opnroadu1c%ta(g5arojus,le) gfelrosmtaienaecdhwisteht eotfhirdeiaucmtibornosmiwdaes, placed the specimens in filtered seawater. Mytilids and the remaining 45 was extracted once with chloro- wswpeeerrceeimtfehrneosnz,enegiitlahlte,rmda7inst0sleCec,teiandddlouracbtefolrreodzmeunbsacgwlshe;o,lseah.enldFlsotriwsdesiruseesemtcahtseesnd e8ftohrMamn/oials.momaSomeyqnluieuanlmccionahgcoeltrae(ta/2uec,4lt:i(1o)pnHsanw5de.8rp)ereapcneidprifto9ar0tmeed/adlwifcotorhlde2a2c.1h500i/nx%-l mRuetagseurrsedUnainvdersliatbeyleodn. dArlyl iscaempalneds swteorreedbartough8t0bCacukntitlo dfoirviadmupallifwiictahtiobno.thWteheusheedav6y0-an7d0lnigghotfsttermapndlaptreimDeNrsAuisneda they were prepared for genetic analysis. 10-/J,! sequencing reaction containing 4.25 /xl FS mix (Ap- DNA extraction, polymerase chain reaction, and pstleireidleBdiiostsiylsltedemHs,2O.FoTshteercyCictlye,-sCeAq)u,enc0i.n2gfpjr.oMfiplrei(me9r5,C/a3n0d sequencing s, 50C/15 s, 60C/4 min) continued for 25 cycles. Electro- Whole cellular DNA was isolated by digesting 0.05-0.1 phoretic separations of the sequencing reactions were per- g of frozen tissue following a hexadecyl-trimethyl-ammo- formed on a Perkin-Elmer ABI 373 DNA sequencer (Foster niumbromide (CTAB)protocol (Doyle and Dickson, 1987), City. CA). followed by a phenol extraction and ethanol precipitation The 507-bp ND4 sequence was edited and aligned in (Sambrook et ai. 1989). Purified nucleic acids were rehy- Auto Assembler (ver. 1.4.0. Applied Biosystems) and Se- drated in IX TE buffer (10 mM Tris-HCl. pH 7.5: 1 mM quence Navigator (ver. 1.0.1. Applied Biosystems). Trans- Table I Musselsamples collectedduringJuly 1997along theMid-Atlantic Ridge (MAR) MID-ATLANTIC RIDGE MUSSELS 267 Table II En-yme buffercombinations usedin ullozyinc electrophoresis En/yme Loci Butter x\stem Aspartale aminotransterase 268 P. A. Y. MAAS ET AL A. ATG TGT ATA GTG CTT TTA GGG GTT TTA GGG GTT CTA GAG GTA TCG GTT GCT GGC 54 TTT TCT TTG CTT GGG GTG CTA GCT ATG CCT TTG TTT CTG TCC GGA AGG TGC TCT 108 GAA ATA AAC GGT ATG TTT AAT TTG GAT TTT TCG GGG CAG ACT CTG GTA ATT CTT 162 AGA ATC TAT ATC ACT TTT TTA ATA TTA ATG GGG AGG GTC ACA GTG TCT CGG TTT 216 ACT GCA TTT AAT AGG CTT ATT GTT TGC ATT GGT GCT TTG TTG GTC GGT GCC TTT 270 ACT GTT AGG GTT ACT TTC CTT TTC TTC GTT CTT TTT GAG GGC GTT TTG TTT CCC 324 ACT TTG CTG TTA ATT GTT GGA TGG GGG TAC CAG CCG GAG CGT TTA CAG GCA GTT 378 GTT TAT ATA GTT ATT TAC ACT GTT ATA GGG TCC CTA CCC CTT TTA TAT GGC TTG 432 GGA AAA CTT TAT TTT CAT GAC GGG AGA GAC AAT TTA TTT AGG TTG GAA TTT GTT 486 CTT GAC AAA ACT ATT TTA AGG 507 B. 1111111111111112222222222223333344444444444455 234557789999990001234455788891233566777881445600112233578900 425453851345692567851817437906858157069182251058176925644212 Al 3 CGATCTCCTACTTCATATGCAGTGTGCGGCCGATTTCCACTTGTTTGAATCTAGAATTCT ( ) A2 1 ...........................................................C ( ) A3 1 C........................................................ ( ) . . . Bl (3,3) TTGCTCTTCGTCCAGCTCATGACACATAATTAGCGCTTGTCCTAGGAGCCTCGAGGGCT . B2 (0,1) ..................................................C......... B3 (0,1) .................*..*..*..*..........T.......................... AAA * * * C. 11334556788896 19263034904942 Al,2,3 (5) GLLTSAVWIVSAF Bl,2 (3,4) VFSSNTIMIVAAW B3 (0,1) V. . . Figure 3. Mitochondria! ND4 haplotypes of the Bathvmodiolus mussels on the Mid-Atlantic Ridge. Haplotype A corresponds to B. n. sp. and haplotype B to B. puteoserpentis. For haplotype A. numbers in parenthesis indicate the number ofsequences for the Lucky Strike site. For haplotype B, the first number in parenthesis is the number from the Snake Pit site and the second is the number from the Logatchev site. (A) completesequenceforB.puieoserpentis. haplotypeBl;(B)Nucleotidepositionsthatdifferbetweenhaplotypes; * indicates non-synonomous substitutions; (C) presumptive amino acid residues that differbetween them. three minor variants that differed by one (Al, A2) or two enzyme, Cac% I, that produced diagnostic fragment profiles (A2, A3) synonymous substitutions. Haplotype B included for each major haplotype (Fig. 4). With the added RFLP variants that differed from each other by one synonymous information, our samples were increased to 12-16 individ- substitution (B!, B2) and differed from a third (B3) by one uals perlocality (Table I), 31 specimens total. No additional non-synonymous substitution. The percentage sequence di- variation was found within localities. vergence within the two major haplotypes was 0.27%. Allozymes Population sun'ey (PCR-RFLP) To quantify within-locality variation, we examined 14 Given small sample sizes, ihe mtDNA sequence informa- allozyme loci (Table II) that previously were used to dis- MAR tion did not exclude the possibility of the alternative hap- criminate among the mytilid species (Craddock etai, lotype also occurring at these putatively monotypic locali- 1995a). Hardy-Weinberg testing of 10 to 11 polymophic ties. To increase the sample size, we used a six-base cutter loci in each population revealed no significant deviations MID-ATLANTIC RIDGE MUSSELS 269 Table III Genetic distances andstandarderrors (inparentheses) hctu'ccn Mid-Atlantic Ridf>e Buthymodiolus species 270 P. A. Y. MAAS ET AL Table V Correlation matrixofsixmorphologicalcharacters (natural log transformed)from Mid-Atlantic Ridge Bathymodiolus species Variable H W U PC-1 PC-2 L MID-ATLANTIC RIDGE MUSSELS 271 basis for separating the two B. puteoserpentis samples. dispersal between the northern and southern localities. It is Clearly, mussels from the Logatchev locality should be worth noting that the Broken Spur site (2910'N) occurs considered B. puteoserpentis. between the Atlantis and Kane Transform Faults, and that it The present genetic and morphometric analyses are con- may contain both MAR species, but mussels were very rare sistent with recognition ofB. puteoserpentis and B. n. sp. as at Broken Spur in 1997. We found no mussels at the nearby distinct species. These mytilids typically express extreme TAG hydrothermal mound, although a few were previously morphological variability that may result from living in observed there. It is possible that this intermediate zone microhabitats that differ greatly in temperature and water (35N to 24N) provides an unsuitable habitat for either chemistry (vonCoseletal., 1997). Although we found some species ofmussel, although other vent-endemic fauna (e.g., overlap in morphometric characteristics of the two species, Rirnicaris exoculata) are abundant at these sites (Van Do- discriminant analysis provided a useful basis for separating ver, 1995). them 95% of the time. Dubious individuals, and possibly Ridge offsets do not appearto provide significantbarriers uilnatrermgreatdheosd,sc.anFirbset,idmetntDifNiAedhwaiptlhotthyepeasppblaiscaetdioonnoaf5m0o7l-ecb-p to dispersal for most vent organisms with a free-swimming portion of the mitochondrial ND4 gene unequivocally dis- larval stage (Vrijenhoek, 1997). Forexample, in the eastern tinguished between the two species. Sequence divergence Pacific, the mussel Bathymodiolus thermophilus and the between B. puteoserpentisandB. n. sp. was 13%. This value vesicomyid clam Calyptogena magnified showed relatively isconsistent with interspecific levels ofdivergence found in little differentiation and high rates ofgene flow among sites parallel studies of other deep-sea modioliform species along the East Pacific Rise and Galapagos Rift (Craddock et (Maas et <;/., unpubl. data). al., 1995b; Karl et al., 1996). All the eastern Pacific sites In contrast, the present degree of allozyme divergence occurred at about the same depth (-2500 m), however. between B. puteoserpentis and B. n. sp. (D = 0.1 12) was Because we have no reason to believe that the Mid-Atlantic low compared to an earlier report (D = 1.179) for mussels mussels' dispersal abilities differ from those of B. ther- from Snake Pit (B. puteoserpentis) and Lucky Strike (B. n. mophilus, it is possible that depth may provide a more We sp.), (Craddock et al., 1995a). This discrepancy can be fundamental barrier to dispersal than ridge offsets. are explained by the larger sample sizes in the present study. currently engaged in a more detailed study ofgene flow and MAR Although the "numberofindividuals to be used forestimat- dispersal in the mytilids. ing genetic distances can also be very small if the genetic distance is large and the average heterozygosity of the two species compared is low" (Nei, 1978, p. 583), these criteria Acknowledgments were not met in the light ofpresent information. We found that heterozygosity was high and genetic distance was low; We thankthecrews andpilots ofthe R/VAtlantisand the therefore, the earlier study confounded intraspecific varia- DSVAlvin fortheircollection efforts and technical support. tion with interspecific differences. We also thank all the scientists aboard R/V Atlantis dur- We are currently using the ND4 haplotypes to better ing MAR 97 for their assistance in the mytilid specimen define theMraAnRges of B. puteoserpentis and B. n. sp. from preparation "assembly line." We are indebted to John additional localities (Fig. 1). Preliminary dataindicate Gold for graciously providing primers. This work was sup- that B. n. sp. is present at northern localities including the ported by NSF grants (OCE-9529819 and OCE-9633131), Menez Gwen, Lucky Strike, and Rainbow hydrothermal an NIH grant (PHSTW00735-01), and an internal grant vent fields, and that B. puteoserpentis occurs at southern for undergraduate research from the Rutgers University localities including Snake Pit and Logatchev. Preliminary Biodiversity Center. This is contribution no. 99-04 of mitochondrial information indicates that both species may the Institute of Marine and Coastal Sciences, and New aodcdciutrioantalanwoirntkerwmietdhiataellloozcaylmietsy.iBsronkeeednedSputro;dheotweervmeirn,e Jersey Agricultural Experiment Station Publication No. D-32104-1-99. whether the two species intergrade at this site. Several MAR ecological factors contribute to separation ofthe two species. The northern localities with B. n. sp. are at shal- lower depths, ranging from 869 m to 2303 m; the southern Literature Cited localities, with B. puteoserpentis, are at greater depths, ranging from 3080 m to 3480 m (Table I). Ridge offsets Alts1c9h9u0l., S.BaFs.,icWl.ocGalisahl,igWn.menMitlsleera,rcEh.toWol..JM.yMeorls.,Bainodl D2.15J:.4L0i3p-m4a1n0.. associated with transform faults create barriers to dispersal Altschul,S.F.,T.L.Madden,A.A.Schaffer,Z.Zhang,W.Miller,and and prevent mixing of some deep-sea vent species (Van D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new gen- Dover. 1990). Three transform faults (Oceanographer at eration of protein database search programs. Nucleic Acids Res. 25: 35N, Atlantis at 30N, and Kane at 24N) may slow 3389-3402. 272 P. A. Y. MAAS ET AL Arevalo,E.,S.K.Davis,andJ.W.J.Sites. 1994. Mitochondria!DNA atic!, D. Hillis and C. Moritz, eds. Sinauer Associates, Sunderland, sequencedivergenceandphylogenetic relationships amongeightchro- MA. mosome races ofthe Sce/operus grammicus complex (Phrynosomati- Nei, M. 1977. F-statistics and analysis ofgene diversity in subdivided dae) in Central Mexico. Sysl. Biol. 43: 387-418. populations. Ann. Hum. Genet. 41: 225-233. Bielawski, J. P., and J. R. Gold. 1996. Unequal synonymous substitu- Nei,M. 1978. Estimationofaverageheterozygosityandgeneticdistance tionrateswithin andbetweentwoprotein-coding mitochondrial genes. from a small numberofindividuals. Genetics 89: 583-590. Mol. Biol. Evoi 13: 880-992. Ota, T. 1993. DISPAN: Genetic Distance and Phylogenetic Analysis. Cabot, E. L., and A. T. Beckenbach. 1989. Simultaneous editing of Pennsylvania State University. University Park. multiple nucleic acid and protein sequences with ESEE, v. 3.0. Rice, W. R. 1989. Analyzing tables of statistical tests. Evolution 43: CABIOS5: 233-234. 223-225. Craddock,C.,W.R.Hoeh,R.G.Gustafson,R.A.Lutz,J. Hashimoto, Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Clon- and R. J. Vrijenhoek. 1995a. Evolutionary relationships among ing, A Laboratory Manual. Cold Spring Harbor Press, Cold Spring deep-sea mytilids (Bivalvia: Mytilidae) from hydrothermal vents and Harbor, NY. cold-water methane/sullide seeps. Mar. Biol. 121: 477-485. SAS Institute. 1986. JMP User's Guide. SAS Institute, Cary, NC. Craddock, C., W. R. Hoeh, R. A. Lutz, and R. C. Vrijenhoek. 1995b. SAS Institute. 1997. SAS Systemfor the Mac OSfor Power PC. SAS Extensive gene flow inthe deep-sea hydrothermal vent mytilidBathy- Institute, Cary, NC. modiolus thermophilus. Mar. Biol. 124: 137-146. Swofford, D. L., and R. K. Selander. 1981. BIOSYS-1: a FORTRAN Desbruyeres,D.,and M. Segonzac. 1997. IntcrRidgeNews.Handbook program for the comprehensive analysis of electrophoretic data in ofDeep-Sea Hydrothermal Vent Fauna. Editions IFREMER, Brest, population genetics and systematics. J. Hered. 72: 281-283. France. Tajima, F., and M. Nei. 1984. Estimation of evolutionary distance DoylDe,NAJ.rJe.s,trainctdioEn.enDdiocnkuscolne.as1e98a7n.alysPirse.seTravxaotnio3n6:of7p1l5a-n7t22s.amples for VanbeDtowveeern,nCu.clLe.ot1i9d9e0.sequBeinocgeeso.gMroalp.hyBioofl.hyEdvrolo.th2e6r9ma-l28v5e.ntcommuni- Guo, S. W., and E. A. Thompson. 1992. Performing the exact test of Hardy-Weinberg proportions formultiple alleles. Biometrics48: 361- VantieDsovaelro,ngCs.eaLf.loo1r99s5p.reaEdcinoglocgeynteorfs.MiTdr-eAntdlsanEtciocl.RiEdvogle.h5y:dr2o4t2h-e2r4m6a.l 372. Gustafson, R. G., R. D. Turner, R. A. Lutz, and R. C. Vrijenhoek. vents. Pp. 257-294 in Hydrothermal Vents and Processes. L. M. 1998. Anewgenusand five speciesofmussels(Bivalvia. Mytilidae) Parson. C. L. Walker, and D. R. Dixon. eds. The Geological Society. flarcoomlodgeieap-4s0e:a6s3u-l1t1i3d.e/hydrocarbon seeps in the GulfofMexico. Ma- vonLCoonsdeoln,.R.,B.Metivier,andJ.Hashimoto. 1994. Threenewspecies Karl, S. A., S. J. Schutz, D. Desbruyeres, R. A. Lutz, and R. C. ofBathymodiolus(Bivalvia: Mytilidae)fromhydrothermalventsinthe Vrijenhoek. 1996. Molecularanalysisofgeneflowinthehydrother- Lau Basin andthe Fiji Basin,Western Pacific,andthe SnakePitArea, mal-ventclam Calvptogena niagnifica. Mol. Mar. Biol. Biotechnol. S: Mid-Atlantic Ridge. Veliger37: 374-392. 193-202. von Cosel, R., T. Comtet, and E. Krylova. 1997. Two new species of Kumar, S., K. Tamura, and M. Nei. 1994. MEGA: Molecular Evolu- Biithvmoilinliis from hydrothermal vents on the Mid-Atlantic Ridge. tionary Genetics Analysis software for microcomputers, v. 1.01. Cull. Biol. Mar. 38: 145-146. CABIOS 10: 189-191. Vrijenhoek, R. C. 1997. Gene flow and genetic diversity in naturally Murphy, R. W.,J. W. Sites Jr., D. G. Buth, and C. H. Houfler. 1990. fragmented metapopulations of deep-sea hydrothermal vent animals. Proteins 1: Isozyme electrophoresis. Pp. 45-126 in MolecularSystem- J. Hered. 88: 285-293.