loading

Logout succeed

Logout succeed. See you again!

ebook img

Forced-unfolding and force-quench refolding of RNA hairpins PDF

file size0.54 MB
languageEnglish

Preview Forced-unfolding and force-quench refolding of RNA hairpins

Forced-unfolding and force-quench refolding of RNA hairpins Changbong Hyeon1 and D. Thirumalai1,2∗ 1Biophysics Program Institute for Physical Science and Technology 6 0 2Department of Chemistry and Biochemistry 0 University of Maryland, 2 College Park, MD 20742 n a J 1 3 ] M (Dated: February 9, 2008) B . o i b - q [ 2 v 3 4 0 1 0 6 0 / o i b - q : v i X r a 1 Abstract Nanomanipulation of individual RNA molecules, using laser optical tweezers, has made it pos- sible to infer the major features of their energy landscape. Time dependent mechanical unfolding trajectories, measured at a constant stretching force (f ), of simple RNA structures (hairpins and S three helix junctions) sandwiched between RNA/DNA hybrid handles show that they unfold in a reversible all-or-none manner. In order to provide a molecular interpretation of the experiments we use a general coarse-grained off-lattice Go-like model, in which each nucleotide is represented usingthreeinteraction sites. Usingcoarse-grained modelwehaveexploredforced-unfoldingofRNA hairpin as a function of f and the loading rate (r ). The simulations and theoretical analysis have S f beendonewithoutandwiththehandlesthat areexplicitly modeledbysemiflexiblepolymerchains. The mechanisms and time scales for denaturation by temperature jump and mechanical unfolding are vastly different. The directed perturbation of the native state by f results in a sequential un- S folding of the hairpin starting from their ends whereas thermal denaturation occurs stochastically. From thedependenceoftheunfoldingrates on r andf weshowthat theposition of theunfolding f S transition state (TS) is not a constant but moves dramatically as either r or f is changed. The f S TS movements are interpreted by adopting the Hammond postulate for forced-unfolding. Forced- unfolding simulations of RNA, with handles attached to the two ends, show that the value of the unfolding force increases (especially at high pulling speeds) as the length of the handles increases. The pathways for refolding of RNA from stretched initial conformation, upon quenching f to the S quench force f , are highly heterogeneous. The refolding times, upon force quench, are at least an Q order of magnitude greater than those obtained by temperature quench. The long f -dependent Q refolding times starting from fully stretched states are analyzed using a model that accounts for the microscopic steps in the rate limiting step which involves the trans to gauche transitions of the dihedral angles in the GAAA tetraloop. The simulations with explicit molecular model for the handles show that the dynamics of force-quench refolding is strongly dependent on the interplay of their contour length and the persistence length, and the RNA persistence length. Using the generality of our results we also make a number of precise experimentally testable predictions. ∗ Corresponding author phone: 301-405-4803;fax: 301-314-9404;[email protected] 2 INTRODUCTION RNA molecules adopt precisely defined three dimensional structures in order to perform specific functions [1]. To reveal the folding pathways navigated by RNA en route to their native conformations requires exhaustive exploration of the complex underlying energy land- scape over a wide range of external conditions. In recent years, mechanical force has been used to probe the unfolding of a number of RNA molecules [2, 3, 4]. Force is a novel way of probing regions of the energy landscape that cannot be accessed by conventional meth- ods (temperature changes or variations in counterion concentrations). In addition, response of RNA to force is relevant in a number of cellular processes such as mRNA translocation through the ribosome and the activity of RNA-dependent RNA polymerases. Indeed, many dynamical processes are controlled by deformation of biomolecules by mechanical force. By exploiting the ability of single molecule laser optical tweezer (LOT) to control the magnitude of the applied force Bustamante and coworkers have generated mechanical un- folding trajectories for RNA hairpins and Tetrahymena thermophila ribozyme [5, 6]. The unfolding of the ribozyme shows multiple routes with great heterogeneity in the unfolding pathways [6]. In their first study [5] they showed that simple RNA constructs (P5ab RNA hairpins or a three helix junction) unfold reversibly at equilibrium. From the time traces of the end-to-end distance (R) of P5ab, for a number of force values, Liphardt et. al. [5] showed that the hairpins unfold in a two-state manner. The histograms of time dependent R (and assuming ergodicity) were used to calculate the free energy difference between the folded and unfolded states. Unfolding kinetics as a function of the stretching force f was S used to identify the position of the transition states [5, 7, 8]. These experiments and sub- sequent studies have established force as a viable way of quantitatively probing the RNA energy landscape with R serving as a suitable reaction coordinate. The experiments by Bustamante and coworkers have led to a number of theoretical and computational studies using a variety of different methods [9, 10, 11, 12, 13, 14]. These studies have provided additional insights into the mechanical unfolding of RNA hairpins and ribozymes. In this paper we build on our previous work [14] and new theoretical analysis to address a number of questions that pertain to mechanical unfolding of RNA hairpins. In addition, we also provide the first report on force-quench refolding of RNA hairpins. The present paper addresses the following major questions: 1) Are there differences in the mechanism of thermal and mechanical unfolding? We expect these two processes to proceed by different pathways because denaturation induced by temperature jump results in a stochastic perturbation of the native state while destabilization by force is due to a directed perturbation. The molecular model for P5GA gives a microscopic picture of these profound differences. 2) For a given sequence does the position of the transition state move in response to changes in the loading rate (r ) or the stretching force f ? Based on the analysis of experi- f S ments over a narrow range of conditions (fixed temperature and loading rate) it has been suggested that the location of the sequence-dependent unfolding transition state (TS) for secondary structure is midway between the folded state while the TS for the ribozyme is close to the native conformation [5]. Explicit simulations show that the TS moves dramatically especially at high values of f and r . As a consequence the S f dependence of the unfolding rate on f deviates from the predictions of the Bell model S 3 [15]. 3) What is the origin of the dramatic differences in refolding by force-quench from stretched conformations and temperature-quench refolding? Experiments by Fernandez and Li [8] on refolding initiated by force-quench on polyubiquitin construct suggest similar differences in the refolding time scales. For RNA hairpins we show that the incompat- ibility of the local loop structures in the stretched state and the folded conformations lead to extremely long refolding times upon force-quench. 4) What are the effects of linker dynamics on forced-unfolding and force-quench refolding of RNA hairpins? The manipulation of RNA is done by attaching a handle or linker to the 3’ and 5’ ends of RNA. Linkers in the LOT experiments, that are done under near-equilibrium conditions, are RNA/DNA hybrid handles. These are appropriately modeled as worm-like chain (WLC). By adopting an explicit polymer model for semi- flexible chains we show that, under certain circumstance, non-equilibrium response of the handle (which is not relevant for the LOT experiments) can alter the forced- unfolding dynamics of RNA. We probe the effects of varying the linker characteristics on the dynamics of folding/unfolding of RNA for the model of the handle-RNA-handle construct. In certain range of r non-equilibrium effects on the dynamics of linkers can f affect the force-extension profiles. METHODS Hairpin sequence: To probe the dynamics of unfolding and force-quench refolding we have studied in detail the 22-nucleotide hairpin, P5GA whose solution structure has been determined by NMR (Protein Data Bank (PDB) id:1eor). In many respects P5GA is similar to P5ab in the P5abc domain of group I intron [16]. Both these structures have GA mismatches and are characterized by the presence of the GAAA tetraloop. The sequence of P5GA is GGCGAAGUCGAAAGAUGGCGCC [17]. RNA model: Because it is difficult to explore, using all atom models of biomolecules in explicit water, unfolding and refolding of RNA hairpins over a wide range of external conditions (temperature (T), stretching force (f ), and quench force (f )), we have S Q introduced a minimal off-lattice coarse-grained model [14] (Throughout the paper we use f for referring to mechanical force in general terms while f and f have specific meaning). In S Q this model each nucleotide is represented by three beads with interaction sites corresponding to the phosphate (P) group, the ribose (S) group, and the base (B) [14]. Thus, the RNA backbone is reduced to the polymeric structure [(P S) ] with the base that is covalently n − attached to the ribose center. In the minimal model the RNA molecule with N nucleotides corresponds to 3N interaction centers. The secondary structure and the lowest energy structure using the minimal model are shown in Fig.1. Energy function: The total energy of a RNA conformation, that is specified by the coordinates of the 3N sites, is written as V = V +V +V +V +V +V . T BL BA DIH STACK NON ELEC Harmonic potentials are used to enforce structural connectivity and backbone rigidity. The 4 connectivity between two beads (P S , S P and B S ) is maintained using i i i i+1 i i 2N−2 N 1 1 V = k ~r ~r (Ro ) 2 + k ~r ~r (Ro ) 2 (1) BL 2 r{| (SP)i+1 − (SP)i|− SP i} 2 r{| Bi − Si|− BS i} Xi=1 Xi=1 where k = 20 kcal/(mol ˚A2), (Ro ) and (Ro ) are the distances between covalently r · SP i BS i bonded beads in PDB structure. The notation (SP) , denotes the ith backbone bead S or i P. The angle θ formed between three successive beads (P S P or S P S ) i i i+1 i−1 i i − − − − along sugar-phosphate backbone is subject to the bond-angle potential, 2N−3 1 V = k (θ θo)2 (2) BA 2 θ i − i Xi=1 where k = 20 kcal/(mol rad2), and θo is the value in the PDB structure. θ · i Dihedral angle potential : The dihedral angle potential (V ) describes the ease of ro- DIH tation around the angle formed between four successive beads along the sugar-phosphate backbone (S P S P or P S P S ). The i-th dihedral angle φ , which is the angle i−1 i i i+1 i i i+1 i+1 i formed between the two planes defined by four successive beads i to i + 3, is defined by cosφ = (~r ~r ) (~r ~r ). In the coarse-grained model the right-handed i i+1,i i+1,i+2 i+2,i+1 i+2,i+3 × · × chirality of RNA is realized by appropriate choices of the parameters in the dihedral po- tential. Based on the angles in the PDB structure (φo), one of the three types of dihedral i potentials, trans (t, 0 < φo < 2π/3), gauche(+) (g+, 2π/3 < φo < 4π/3), gauche( ) (g−, i i − 4π/3 < φo < 2π), is assigned to each of the four successive beads along the backbone. The i total dihedral potential of the hairpin is 2N−4 V = [Aη +Bη +Cη DIH 1i 1i 1i Xi=1 + Aη cos(φ φo +φη)+Bηcos3(φ φo +φη)+Cηsin(φ φo +φη)] (3) 2i i − i i 2i i− i i 2i i − i i where the parameters (in kcal/mol) defined for t, g+, and g− are A = 1.0, A = 1.0, B = B = 1.6, C = 2.0, C = 2.0 (η = g+), 1i 2i 1i 2i 1i 2i − − A = 1.0, A = 1.0, B = B = 1.6, C = 2.0, C = 2.0 (η = g−), 1i 2i 1i 2i 1i 2i − A = A = 1.2, B = B = 1.2, C = C = 0.0 (η = t). 1i 2i 1i 2i 1i 2i To account for the flexibility in the loop region we reduce the dihedral angle barrier by halving the parameter values in 19 i 24. ≤ ≤ Stacking interactions: Simple RNA secondary structures, such as hairpins, are largely stabilized by stacking interactions whose context dependent values are known [18, 19, 20]. The folded P5GA RNA hairpin is stabilized by nine hydrogen bonds between the base pairs (see Fig.1-B) including two GA mismatch pairs [17]. The stacking interactions that stabilize a hairpin can be written as V = nmaxV (n = 8 in P5GA). We assume that the STACK i=1 i max orientation-dependent Vi is P Vi( φ , ψ , r ;T) = ∆Gi(T) e−αst{sin2(φ1i−φo1i)+sin2(φ2i−φo2i)+sin2(φ3i−φo3i)+sin2(φ4i−φo4i)} { } { } { } × e−βst{(rij−r1oi)2+(ri+1j−1−r2oi)2} × e−γst{sin2(ψ1i−ψ1oi)+sin2(ψ2i−ψ2oi)} (4) × 5 where ∆G(T) = ∆H T∆S, the bond angles φ are φ ∠S B B , φ ∠B B S , 1i i i j 2i i j j − { } ≡ ≡ φ ∠S B B , φ ∠B B S , the distance between two paired bases 3i i+1 i+1 j−1 4i i+1 j−1 j−1 ≡ ≡ r = B B , r = B B , and ψ and ψ are the dihedral angles formed by ij i j i+1j−1 i+1 j−1 1i 2i | − | | − | the four beads B S S B and B S S B , respectively. The superscript o refers to i i i+1 i+1 j−1 j−1 j j angles and distances in the PDB structure. The values of α , β and γ are 1.0, 0.3˚A−2 st st st and 1.0 respectively. We take ∆H and ∆S from Turner’s thermodynamic data set [18, 19]. There are no estimates for GA related stacking interactions. Nucleotides G and A do not typically form a stable bond and hence GA pairing is considered a mismatch. We use the energy associated with GU for GA base pair. Nonbonded interactions: We use the Lennard-Jones interactions between non-bonded interaction centers to account for the hydrophobicity of the purine/pyrimidine groups. The total nonbonded potential is N−1 N N 2N−1 2N−4 2N−1 V = V (r)+ ′V (r)+ V (r) (5) NON BiBj Bi(SP)m (SP)m(SP)n Xi=1 jX=i+1 Xi=1 mX=1 mX=1 n=Xm+3 where r = ~r ~r . The prime in the second term on the Eq.(5) denotes the condition i j | − | m = 2i 1. In our model, a native contact exists between two non-covalently bound beads 6 − provided they are within a cut-off distance r (=7.0˚A). Two beads beyond r are considered c c to be non-native. For a native contact, ro ro V (r) = Cξiηj[( ij)12 2( ij)6] (6) ξiηj h r − r where ro is the distance between beads in PDB structure and Cξiηj = 1.5 kcal/mol for all ij h native contact pairs except for B B base pair associated with the formation of the hairpin 10 13 loop, for which CB10B13 = 3.0 kcal/mol. The additional stability for the base pair associated h with loop formation is similar to the Turner’s thermodynamic rule for the free energy gain in the tetraloop region. For beads beyond r the interaction is c a a V (r) = C [( )12 +( )6] (7) ξiηj R r r with a = 3.4˚A and C = 1 kcal/mol. The value of Cξiηj(= 1.5kcal/mol) has been chosen R h so that the hairpin undergoes a first order transition from unfolded states. Our results are not sensitive to minor variations in C . h Electrostatic interactions: The charges on the phosphate groups are efficiently screened by counterions so that in the folded state the destabilizing contribution of the electrostatic potential is relatively small. However, the nature of the RNA conformation (especially tertiary interactions) can be modulated by changing counterions. For simplicity, we as- sume that the electrostatic potential between the phosphate groups is pairwise additive V = N−1 N V (r). For V (r) we use Debye-Hu¨ckel potential, which ac- ELEC i=1 j=i+1 PiPj PiPj counts for PscreeniPng by condensed counterions and hydration effects, and is given by z z e2 V = Pi Pj e−r/lD (8) PiPj 4πǫ ǫ r 0 r 6 where z = 1 is the charge on the phosphate ion, ǫ = ǫ/ǫ and the Debye length Pi − r 0 l = ǫrkBT with k = 1 = 8.99 109JmC−2. To calculate the ionic strength D q8πkelece2I elec 4πǫ0 × I = 1/2 z2c , we use the value c = 200mM-NaCl from the header of PDB file i i i i [17]. We Puse ǫ = 10 in the simulation [21]. Because the Debye screening length √T r ∼ the strength of electrostatic interactions between the phosphate groups are tempera- ture dependent even when we ignore the variations of ǫ with T. At room temperature (T 300 K) the electrostatic repulsion between the phosphate groups at r 5.8 ˚A, ∼ ∼ which is the closest distance between phosphate groups, is V 0.5 kcal/mol. Thus, PiPi+1 ∼ V between phosphate groups across the base pairing (r = 16 18 ˚A) is almost negligi- ELEC ∼ ble. The Debye-Hu¨ckel interactions is most appropriate for monovalent counterions like Na+. Models for linker or “handles”: Inlaseropticaltweezer (LOT)experiments theRNA molecules are attached to the polystyrene beads by an RNA/DNA hybrid handles or linker. Aschematic illustrationofthepulling simulations thatmimictheexperimental setups forthe laser optical tweezer (LOT) (Fig.2-A) is shown in Fig.2-B. Globally, the principles involved in atomic force microscope (AFM) and LOT for mechanical unfolding of biomolecules are essentially the same except for the difference in the effective spring constant. The spring constant of the nearly harmonic potential of the optical trap is in range k = 0.01 0.1 − pN/nm whereas the cantilever spring in AFM experiments (Fig.2-B) is much stiffer and varies from 1 10 pN/nm. To fully characterize the RNA energy landscape it is necessary − to explore a wide range of loading rates [22]. To vary r we have used different values of k f in the simulations. We simulate mechanical unfolding of RNA hairpins either by applying a constant force on the 3’-end with the 5’-end being fixed (unfolding at constant force), or by pulling the 3’-end through a combination of linkers and harmonic spring (Fig.2-B) at a constant speed in one direction (unfolding atconstant loading rate). Comparison ofthe results allows us to test the role of the linker dynamics on the experimental outcome. If the linker is sufficiently stiff then it should not affect the dynamics of RNA. On the other hand, unfolding at constant loading rate (r k v, where v is the pulling speed and the stretching force (f ) is computed f S ≡ × using f = k δz with δz being the displacement of the spring) can be modulated either by × changingk orv. Insteadofk aneffective springconstantk ,withk−1 = k−1 +k−1 +k−1 , eff eff eff linker mol should be used to compute the loading rate. Typically, k−1 and k−1 (where k is the linker mol mol stiffness associated with the model) are small and, hence k k. In this setup, the relevant eff ≈ variables are k, v, and the contour length (L) of the linker and the effective stiffness of the linker. We explore the effects of these factors by probing changes in the force extension curve (FEC). The variations in L are explored only using constant loading rate simulations. Manosas and Ritort [13] used an approximate method to model linker dynamics. The energy function for the linker molecule is N−1 N−2 k V = B(r b)2 k rˆ rˆ (9) L i,i+1 A i,i+1 i+1,i+2 2 − − · Xi=1 Xi=1 where r and rˆ are the distance and unit vector connecting i and i + 1 residue, i,i+1 i,i+1 respectively. For the bond potential we set k = 20 kcal/(mol ˚A2) and b = 5 ˚A. This B · form of the energy function describes the worm-like chain (WLC) [23] (appropriate for RNA/DNA hybrid handles used by Liphardt et. al. [5]) when k is large. The linker A 7 becomes more flexible as the parameter describing the bending potential, k , is reduced. A Thus, by varying k the changes in the entropic elasticity of the linker on RNA hairpin A dynamics can be examined. We use k = 80 kcal/mol or 20 kcal/mol to change the A flexibility of the linker. For the purpose of computational efficiency, we did not include excluded volume interactions between linkers or between the linker and RNA. When linkers are under tension the chains do not cross unless thermal fluctuations are larger than the energies associated with force. To study the linker effect on force extension curves (FEC), we attach two linker polymers each with the contour length L/2 to the ends of the hairpin and stretch the molecule using the single pulling speed 0.86 102 µm/s × withspringconstantk = 0.7pN/nm. ThetotallinkerlengthisvariedfromL = (10 50)nm. − Simulations: We assume that the dynamics of the molecules (RNA hairpins and the linkers) can be described by the Langevin equation. The system of Langevin equations is integrated as described before [14, 24]. Using typical values for the mass of a bead in a nucleotide (B , S or P ), m = 100 g/mol 160 g/mol, the average distance between i i i ∼ the adjacent beads a = 4.6 ˚A, the energy scale ǫ = 1 2 kcal/mol, the natural time is h ∼ τ = (ma2)1/2 = 1.6 2.8 ps. We use τ = 2.0 ps to convert the simulation times into L ǫh ∼ L real times. To estimate the time scale for thermal and mechanical unfolding dynamics we use a Brownian dynamics algorithm [25, 26] for which the natural time for the overdamped motion is τ = ζǫhτ . We use ζ = 50τ−1, which approximately corresponds to friction H T L L constant in water, in the overdamped limit. To probe the thermodynamics and kinetics of folding we used a number of physical quantities (end-to-end distance (R), fraction of native contacts (Q), the structural overlap function (χ), number of hydrogen bonds n , etc) to bond monitor the structural change in the hairpin. Computation of free energy profiles: We adopted the multiple histogram technique [27, 28] to compute the thermodynamic averages of all the observables at various values of T and f. For example, the thermodynamic average of the fraction of native contact, Q, can be obtained at arbitrary values of T and f if the conformational states are well sampled over a range of T and f values. The thermodynamic average of Q is given by Qe−(E−fR)/T Kk=1hk(E,R,Q) Q(T,f) = E,R,Q Kk=1Pnke(Fk−(E−fkR))/Tk QP[Q(T,f)] (10) h i P e−(E−fR)/T P Kk=1hk(E,R,Q) ≡ X E,R,Q Kk=1Pnke(Fk−(E−fkR))/Tk Q P P where K is the number of histograms, h (E,R,Q) is the number of states between E and k E + δE, R and R + δR, Q and Q + δQ in the k-th histogram, n = h (E,R,Q), k E,R,Q k Tk and fk are the temperature and the force in the simulations used toPgenerate the k th − histogram, respectively. The free energy, F , that is calculated self-consistently, satisfies k K h (E,R,Q) e−Fr/Tr = e−(E−frR)/Tr k=1 k . (11) EX,R,Q KkP=1nke(Fk−(E−fkR))/Tk P Using the low friction Langevin dynamics, we sampled the conformationalstates in the (T,f) in the range 0 K < T < 500 K,f = 0.0 pN and 0.0 pN < f < 20.0 pN,T = 305 K . { } { } Exhaustive samplings around the transition regions at 305 K T 356 K, f = 0.0 pN { ≤ ≤ } and 5.0 pN f 7.0 pN, T = 305 K is required to obtain reliable estimates of the { ≤ ≤ } 8 thermodynamic quantities. The free energy profile, with Q as an order parameter, is given by F[Q(T,f)] = F (T,f) k T logP[Q(T,f)]. (12) o B − where F (T,f) = k T logZ(T,f), Z(T,f) = e−(E−fR)/T Kk=1hk(E,R,Q) o − B E,R,Q Kk=1Pnke(Fk−(E−fkR))/Tk and P[Q(T,f)] is defined in Eq.(10). The free enerPgy profile F(R) wPith R as a reaction coordinate can be obtained using a similar expression. RESULTS Mechanisms of thermal denaturation and forced-unfolding are different: We had previously reported [14] the thermodynamic characteristics of the P5GA hairpin as a function of T and f. The native structure of the hairpin, that was determined using a combination of multiple slow cooling, simulated annealing, and steepest descent quench, yielded conformations whose average root mean square deviation (RMSD) with respect to the PDB structure is about 0.1 ˚A [14]. The use of Go-like model leads to a small value of RMSD. Fromthe equilibrium (T,f) phase diagramin [14]the melting temperature T 341 m ≈ K at f = 0. Just as in thermal denaturation at T at zero f the hairpin unfolds by a weak S m first order transition at an equilibrium critical force f . Above f , which is a temperature- c c dependent, the folded state is unstable. Tomonitorthepathwaysexploredinthethermaldenaturationweinitiallyequilibratedthe conformations at T = 100 K at which the hairpin is stable. Thermal unfolding (f = 0) was initiated by a temperature jump to T = 346 K > T . Similarly, forced-unfolding is induced m by applying a constant force f = 42 pN to thermally equilibrated initial conformation at S T = 254 K [14]. The value of f = 42 pN far exceeds f = 15 pN at T = 254 K. Upon S c thermal denaturation, the nine bonds fluctuate (in time) stochastically in a manner that is independent of one another until the hairpin melts (Fig.3-A). Forced-unfolding, on the other hand, occurs in a directed manner. Mechanical unfolding occurs by sequential unzipping with force unfolding the bond, from the ends of the hairpin (beginning at bond 1) to the loop (Fig.3-B). The differences in the folding pathways are also mirrored in the free energy profiles. Assuming that Q is an adequate reaction coordinate for thermal unfolding [29] we find, by comparing F(Q) at T = 100 K and T = 346 K, that thermal melting occurs by crossing a barrier. The native basin of attraction (NBA) at Q = 0.9 at T = 100 K is unstable at the higher temperature and the new equilibrium at Q 0.2 is reached in an apparent two state ∼ manner (Fig.3-C). Upon “directed” mechanical unfolding the free energy profile F(R) is tilted from the NBA at R 1.5 nm to R 12 nm at which the stretched states are favored ≈ ≈ at f = 42 pN. The forced-unfolding transition also occurs abruptly once the activation barrier at R 1.5 nm (close to the folded state) is crossed (Fig.3-D). ≈ Free energy profiles and transition state (TS) movements: Based on the prox- imity of the average transition state location, ∆xTS, it has been suggested that folded states F of RNA [6] and proteins [7] are brittle. If the experiments are performed by stretching at a constant loading rate then ∆xTS is calculated using f∗ k T/∆xTS logr [30] where f∗ is F ∼ B F f the most probable unfolding force and r , the loading rate, is r = df/dt = kv. Substantial f f curvatures in the dependence of f∗ on logr ([f∗,logr ] plot) have been observed especially f f 9 if r is varied over a wide range [22]. Similarly, in constant force unfolding experiments f ∆xTS is obtained from the Bell equation [15] that relates the unfolding rate to the applied F force, logk = logko + f∆xTS/k T where ko is the unfolding rate in the absence of U U F B U force. In the presence of curvature in the [f∗,logr ] plots or when the Bell relationship is f violated [31] it is difficult to extract meaningful values of ko or ∆xTS by a simple linear U F extrapolation. By carefully examining the origin of curvature in the [f∗,logr ] plot or in f k as we show that in the unfolding of hairpin the observed non-linearities are due to U movements in the transition state ensemble i.e., ∆xTS depends on f and r . F S f Unfolding at constant loading rate: We performed forced unfolding simulations by varying both the pulling speed v and the spring constant k so that a broad range of loading rates can be covered. The unfolding forces at which all the hydrogen bonds are ruptured are broadly distributed with the average and the dispersion that increase with growing loading rates (Fig.4-A). The plot of f∗ as a function of logr (Fig.4-B) shows marked departure f from linearity. The slope of the plot ([f∗,logr ]) increases sharply as r increases. There are f f two possible reasons for the increasing tangent. One is the reduction of ∆xTS, which would F lead to an increase in the slope (k T/∆xTS) of f∗ vs logr . The other is the increase of B F f curvature at the transition state region, i.e., barrier top of free energy landscape. Regardless of the precise reason, it is clear that the standard way of estimating ∆xTS using f∗ at large F loading rates results in a very small value of ∆xTS. We estimate ∆xTS from [f∗,logr ] plot F F f to be 4 ˚A at r 105 pN/s. The estimated value of ∆xTS is unphysical because 4 ˚A is less f ≈ F than the average distance between neighboring P atoms. The minimum pulling speed used in our simulations is nearly five orders of magnitude greater than in experiments. The use of large loading rate results in small values of ∆xTS. If the simulations can be performed F at small values of r we expect the slope of f∗ vs logr to decrease, which would then give f f rise to physically reasonable values of ∆xTS at low r . Our simulations suggest that the F f curvature in the plot of f∗ as a function of logr is due to the dependence of ∆xTS on r f F f and not due to the presence of multiple transition states [22]. As a result, extrapolation to low r values can give erroneous results (Fig.4-B). f Unfolding at constant force: To monitor the transition state movements we performed a number of unfolding simulations by applying f > 20 pN at T = 290 K. The unfolding S rates are too slow at f < 20 pN to be simulated. Nevertheless, the simulations give strong S evidence for force-dependent movement of ∆xTS. For a number of values of f in the range F S 20 pN < f < 150 pN we computed the distribution of first passage times for unfolding. S The first passage time for the i-th molecule is reached if R becomes R = 5 nm for the first time. From the distribution of first passage times (for about (50-100) molecules at each f ) S we calculated the mean unfolding time. Just as for unfolding at constant r the dependence f of logτ on f shows curvature (Fig.5-A), and hence deviates from the often used Bell model U S [31]. By fitting τU to the Bell formula (τU = τUoe−fS∆xTFS/kBT), over a narrow range of fS we obtain ∆xTS 4˚A which is too small to be physically meaningful at f = 0. F ≈ S Insights into the shift of ∆xTS as f increases can be gleaned from the equilibrium F S force-dependent free energy F(R) as a function of R. The one-dimensional free energy profiles F(R) show significant movements in ∆xTS as f changes (Fig.5-C). As f increases F S S ∆xTS decreases sharply, which implies that the unfolding TS is close to the folded state. F At smaller values of f the TS moves away from the native state. At the midpoint of S 10

See more

The list of books you might like