Logout succeed
Logout succeed. See you again!
Foot-and-mouth disease virus viroporin 2B antagonizes RIG-I mediated antiviral effects by PDF
Preview Foot-and-mouth disease virus viroporin 2B antagonizes RIG-I mediated antiviral effects by
JVI Accepted Manuscript Posted Online 5 October 2016 J. Virol. doi:10.1128/JVI.01310-16 Copyright © 2016 Zhu et al. This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International license. Foot-and-mouth disease virus viroporin 2B antagonizes 1 RIG-I mediated antiviral effects by inhibition of its protein 2 expression 3 4 5 Zixiang Zhu1#, Guoqing Wang1#, Fan Yang1, Weijun Cao1, Ruoqing Mao1, Xiaoli Du1, D o 6 Xiangle Zhang1, Chuntian Li1, Dan Li1, Keshan Zhang1, Hongbing Shu2, Xiangtao w n lo 7 Liu1, Haixue Zheng1* ad e d 8 f r o m 9 1State Key Laboratory of Veterinary Etiological Biology, National Foot and Mouth h t 10 Diseases Reference Laboratory, Key Laboratory of Animal Virology of Ministry of tp : / 11 Agriculture, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural /jv i. 12 Sciences, Lanzhou 730046, China; 2Collaborative Innovation Center for Viral as m 13 Immunology, Medical Research Institute, Wuhan University, Wuhan 430072, China. . o r g 14 / o n 15 #These authors contributed equally to this work. A p r 16 *Corresponding author. il 3 , 2 17 Mailing address for Haixue Zheng, Ph.D: Lanzhou Veterinary Research Institute, 0 1 9 b 18 Chinese Academy of Agricultural Sciences, No. 1, Xujiaping Road, Lanzhou 730046, y g u 19 China. Phone: 86-931-8342710. Fax: 86-931-8340977. Email: e s t 20 [email protected]. 21 Running title: FMDV 2B inhibits RIG-I protein expression 22 Abstract word count: 215 23 Main text word count: 6467 1 24 ABSTRACT 25 The role of retinoic acid-inducible gene I (RIG-I) in foot-and-mouth disease virus 26 (FMDV)-infected cells remains unknown. Herein, we showed that RIG-I inhibits 27 FMDV replication in host cells. FMDV infection increased the transcription of RIG-I, 28 while it decreased RIG-I protein expression. A detailed analysis revealed that FMDV D 29 leader proteinase (Lpro), as well as 3C proteinase (3Cpro) and 2B protein, decreased o w n 30 RIG-I protein expression. Lpro and 3Cpro are viral proteinases that can cleave various lo a d 31 host proteins and are responsible for several of the viral polyprotein cleavages. e d f r 32 However, for the first time, we observed 2B-induced reduction of host protein. om h 33 Further studies showed that 2B-mediated reduction of RIG-I is specific to FMDV, but tt p : / / 34 not other picornaviruses including encephalomyocarditis virus, enterovirus 71, and jv i. a s 35 coxsackievirus A16. Moreover, we found the decreased protein level of RIG-I is m . o r 36 independent of the cleavage of eukaryotic translation initiation factor 4 gamma, the g / o n 37 induction of cellular apoptosis, or the association of proteasomes, lysosomes and A p r 38 caspases pathways. A direct interaction was observed between RIG-I and 2B. The il 3 , 39 carboxyl terminal amino acids 105–114 and 135–144 of 2B were essential for the 20 1 9 40 reduction of RIG-I, while residues 105–114 were required for the interaction. These b y g 41 data suggest the antiviral role of RIG-I against FMDV and a novel antagonistic u e s t 42 mechanism of FMDV that is mediated by 2B protein. 2 43 IMPORTANCE 44 This study demonstrated that RIG-I could suppress FMDV replication during virus 45 infection. FMDV infection increased the transcriptional expression of RIG-I, while it 46 decreased RIG-I protein expression. FMDV 2B protein interacted with RIG-I and 47 induced reduction of RIG-I. 2B-induced reduction of RIG-I was independent of the D o w 48 induction of the cleavage of eukaryotic translation initiation factor 4 gamma or n lo a 49 cellular apoptosis. In addition, proteasomes, lysosomes and caspases pathways were d e d 50 not involved in this process. This study provides new insight into the immune evasion f r o m 51 mediated by FMDV and identifies 2B as an antagonistic factor for FMDV to evade h t t p 52 the antiviral response. :/ / jv i. a s m . o r g / o n A p r il 3 , 2 0 1 9 b y g u e s t 3 53 Foot-and-mouth disease virus (FMDV) is a single-stranded positive-sense RNA virus 54 that causes foot-and-mouth disease (FMD) in cattle, pigs, and various cloven-hoofed 55 animals(1). FMDV genome consists of a 5′ untranslated region (UTR), an integral 56 open reading frame (ORF), and a 3′ UTR with a polyadenylic acid [poly(A)] tail. The 57 ORF encodes a polyprotein, which is subsequently proteolysed into at least 13 D o 58 proteins such as VP1, VP2, VP3, VP4, leader proteinase (Lpro), 2A, 2B, 3A, 3B1, 3B2, w n lo 59 3B3, 3Cpro and 3Dpol(2, 3). FMDV 2B protein is a nonstructural protein that is ad e d 60 involved in the re-arrangement of host cell membranes and disruption of the cellular f r o m 61 secretory pathway(4, 5). FMDV 2B is a ~17-kDa protein comprising 154 amino acids. h t t p 62 Two hydrophobic domains are identified in the N terminus of 2B, which is thought to :/ / jv 63 tether 2BC to the endoplasmic reticulum (ER)(5). A bioinformatics analysis implies i.a s m 64 that the carboxyl terminal region of 2B is involved in membrane interaction, which is .o r g / 65 important for virus replication(6). The 2B protein of other picornaviruses is reported o n A 66 to be involved in virus-induced cytopathic effects, blocking cellular protein secretion, p r il 3 67 and impairing apoptotic responses during virus infection (7-9), whereas, the multiple , 2 0 68 accessory functions of FMDV 2B during viral infection remain unclear. 1 9 b 69 Retinoic acid-inducible gene I (RIG-I) is a pattern recognition receptor (PRR) that y g u e 70 is essential for sensing invading pathogens and initiating the innate immune s t 71 response(10). RIG-I is activated by infection with various RNA viruses. Activation of 72 RIG-I is responsible for the induction of type I interferon (IFN) and expression of 73 many cytokines and chemokines. The caspase activation and recruitment domains of 74 RIG-I interact with virus-induced signaling adapter (VISA) and then recruits 4 75 TANK-binding kinase 1 (TBK1) and TNF receptor associated factor 6, which finally 76 induce the expression of type I IFNs and inflammatory cytokines through activation 77 of IFN-regulatory factor (IRF)3, IRF7 and nuclear factor (NF)-κB transcription 78 factors(11). The secreted type I IFNs subsequently transmit signals to cognate IFN 79 receptors and induce expression of various IFN-inducible genes to initiate an antiviral D o w 80 response(12). In addition to the canonical PRR function, RIG-I can also directly n lo a 81 function as an antiviral effector in the absence of IFN signaling (13, 14). d e d 82 RIG-I recognizes a variety of RNAs from influenza A virus (IAV), f r o m 83 paramyxoviruses (PMV), Sendai virus (SeV), vesicular stomatitis virus (VSV) and h t t p 84 hepatitis C virus (HCV)(15, 16); whereas, the sensing of picornavirus RNA is :/ / jv 85 primarily mediated by melanoma differentiation-associated protein (MDA)5(17, 18). i.a s m 86 Whether RIG-I functions as a viral sensor during FMDV infection remains unclear; .o r g / 87 however, it is believed that RIG-I also plays a role during picornavirus infection(19). o n A 88 RIG-I is cleaved during poliovirus, rhinovirus, echovirus and encephalomyocarditis p r il 89 virus (EMCV) infection, and viral proteinase 3Cpro induces this cleavage (19). The 3, 2 0 90 cleavage of RIG-I possibly contributes to the attenuated antiviral responses. 1 9 b 91 Despite the cleavage of RIG-I in several picornaviruses, RIG-I is speculated to y g u e 92 have different roles in different picornavirus infections(19-22), and little is known s t 93 about the state and function of RIG-I in FMDV-infected cells. The present study 94 determined the antiviral activity of RIG-I and the state of RIG-I during FMDV 95 infection. FMDV 2B protein showed a novel property of inducing reduction of RIG-I. 96 Therefore, we demonstrated the antiviral role of RIG-I against FMDV and explored a 5 97 novel antagonistic mechanism of FMDV. 98 99 MATERIALS AND METHODS 100 101 Cells, viruses and infection. Porcine kidney PK-15 cells, baby hamster kidney-21 D o w 102 (BHK-21) and human embryonic kidney 293T (HEK293T) cells were cultured in n lo a 103 Dulbecco's modified Eagle medium (Gibco) supplemented with 10% heat-inactivated d e d 104 fetal bovine serum (FBS) (Gibco) and maintained at 37 °C (5% CO2). FMDV type O fr o m 105 strain O/BY/CHA/2010 and type Asia 1 isolate Asia1/HN/2006 were used for viral h t t p 106 challenge. The viruses were propagated in BHK-21 cells. Viral infection experiments :/ / jv 107 were carried out as described previously (23). The 50% tissue culture infective dose i.a s m 108 (TCID50) values were determined using the Reed-Muench method. The Sendai virus .o r g / 109 (SeV) used in this study and its infection method have been described previously (24). o n A 110 p r il 3 111 Plasmids and antibodies. The cDNA of porcine RIG-I were amplified from , 2 0 112 PK-15 cells and cloned into pcDNATM3.1/myc-His(-)A vector (Invitrogen) to yield 1 9 b 113 the Myc-tagged expression construct (Myc-RIG-I). Each of FMDV full-length viral y g u e 114 cDNA was inserted into p3xFLAG-CMV-7.1 vector (Sigma-Aldrich) to construct s t 115 plasmids expressing Flag-tagged viral proteins. A series of Flag-tagged truncated 2B 116 constructs were generated by site-directed mutagenesis PCR. All constructed plasmids 117 were analyzed and verified by DNA sequencing. The IFN-β promoter luciferase 118 reporter plasmids and various hemagglutinin (HA)-tagged plasmids used in this study 6 119 were kindly provided by Professor Hongbing Shu (Wuhan University, China)(25). 120 The commercial antibodies used in this study include: anti-Myc monoclonal antibody 121 (Santa Cruz Biotechnology), anti-Flag monoclonal antibody (Santa Cruz 122 Biotechnology), anti-Flag polyclonal antibody (Sigma-Aldrich), anti-RIG-I polyclonal 123 antibody (Abcam), anti-HA tag antibody (BioLegend), anti-eukaryotic translation D o w 124 initiation factor 4 gamma (eIF4G) polyclonal antibody (Abcam) and anti-β-actin n lo a 125 monoclonal antibody (Santa Cruz Biotechnology). Anti-VP1 polyclonal antibody was d e d 126 prepared by our laboratory (unpublished data). f r o m 127 h t t p 128 Establishment of an RIG-I knockout PK-15 cell line using the CRISPR/Cas9 :/ / jv 129 system. The pX330 plasmid expressing Cas9 (Addgene plasmid 42230) was digested i.a s m 130 with BbsI (NEB) and ligated to annealed single guide RNA (sgRNA) oligonucleotides .o r g / 131 targeting porcine RIG-I. The sgRNA sequence used in this study was designed using o n A 132 the online CRISPR design tool (http://crispr.mit.edu/), and the sequence was p r il 3 133 5'–GCGGAATCTGCACGCTTTCG–3'. PK-15 cells were seeded into 12-well plates , 2 0 134 at a density of 3×105 cells, the monolayer cells were transfected with the constructed 1 9 b 135 plasmid (2 μg each well) for 72 hours (hours = "h") prior to genomic DNA extraction. y g u e 136 For PCR analysis of RIG-I genomic DNA, total genomic DNA was extracted using s t 137 DNeasy Blood and Tissue Kit (QIAGEN) following manufacturer’s protocol. The 138 DNA pellet was dried and resuspended in double-distilled water. The genomic region 139 surrounding the CRISPR target site was amplified by PCR using the check primers 140 (forward: 5'-AAGTGGTTACACCGCATACA-3'; reverse: 7 141 5'-CACCTCAAACTCCGACAATC-3'), and the products were purified and 142 re-annealed as described previously(26). The T7 Endonuclease I (NEB) was used to 143 confirm the genome editing of RIG-I. Digested DNA was separated and analyzed on a 144 1.5% agarose gel. After confirmation of the activity of the designed sgRNA, the 145 transfected PK-15 cells were plated by limiting dilution, and the RIG-I knockout D o w 146 PK-15 cell line was established by the limiting dilution method in 96-well plates (0.5 n lo a 147 cell each well). The genomic DNA of the cells cultured from a single-cell clone was d e d 148 amplified using the check primers. The PCR products were purified and ligated into f r o m 149 pMD-18T vectors; six plasmids for each sample were sequenced to ensure the h t t p 150 frame-shifting mutation of both alleles of the established cell line. The western blot :/ / jv 151 analysis was performed to confirm that RIG-I was not expressed in the RIG-I i.a s m 152 knockout cell line; the wild-type (WT) PK-15 cell was used as a control. .o r g / 153 o n A 154 Co-immunoprecipitation and western blot analysis. HEK293T cells were p r il 3 155 cultured in 10-cm dishes, and the monolayer cells were co-transfected with various , 2 0 156 plasmids. Then collected cells were lysed and immunoprecipitated as described 1 9 b 157 previously(27). For western blotting, target proteins were resolved by SDS-PAGE and y g u e 158 transferred onto an Immobilon-P membrane (Millipore). The membrane was then s t 159 blocked and incubated with appropriate primary antibodies and secondary antibodies 160 as described previously(28). The antibody–antigen complexes were visualized using 161 enhanced chemiluminescence detection reagents (Thermo). For the 162 co-immunoprecipitation assay to detect the interaction between RIG-I and 2B, the 8 163 highly sensitive SuperSignal™ West Femto Maximum Sensitivity Substrate Kit 164 (Thermo) which can detect extremely low amount of proteins was used to visualize 165 the antibody–antigen complexes. 166 167 Indirect immunofluorescence microscopy. HEK293T cells (3×105) were grown D o w 168 on Nunc™ glass bottom dishes. At 24 h post-transfection (hpt), the cells were covered n lo 169 by acetone/methanol mixture (1:1) for fixation at -20℃ (10 min). The specimens were ad e d 170 blocked in the blocking buffer (5% normal goat serum in PBS) for 1 h at 37℃. Then, f r o m 171 the cells were incubated with anti-Myc and anti-Flag primary antibodies overnight at h t t p 172 4℃. The specimens were then incubated with fluorochrome-conjugated secondary :/ / jv 173 antibodies in dark for 1 h at room temperature. After incubation with secondary i.a s m 174 antibodies, the cells were covered with 4′,6-diamidino-2-phenylindole (DAPI) for 10 .o r g / 175 minutes to stain the nuclei. The stained cells and fluorescence were visualized using a o n A 176 Nikon eclipse 80i fluorescence microscope with appropriate settings. The microscopy p r il 3 177 images were processed using NIS Elements F 2.30 software. , 2 0 178 1 9 b 179 RNA extraction and quantitative PCR (qPCR). Total RNAs were extracted y g u 180 using TRIzol® Reagent (Invitrogen). The cDNA was synthesized from the extracted es t 181 RNA samples, using the M-MLV reverse transcriptase (Promega) and random 182 hexamer primers (TaKaRa). The generated cDNA was used as the template to detect 183 expression of FMDV RNA and host cellular mRNA. The Mx3005P QPCR System 184 (Agilent Technologies) and SYBR Premix Ex Taq reagents (TaKaRa) were used in the 9 185 qPCR experiment to quantify the abundance of various mRNAs. The 186 glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene was determined as an 187 internal control. Relative expression of mRNA was calculated using the comparative 188 cycle threshold (CT) (2−ΔΔCT) method (29). All the experiments were repeated three 189 times with similar results. The data represent results from one of the triplicate D o w 190 experiments. *P<0.05 considered significant; **P<0.01 considered highly significant. n lo a 191 d e d 192 Flow cytometric analysis of apoptosis by Annexin V-FITC/ propidium iodide f r o m 193 (PI) staining. Annexin V-propidium iodide (AnnV-PI) staining assay using flow h t t p 194 cytometry was performed to evaluate 2B-induced apoptosis in PK-15 cells. 5×105 :/ / jv 195 cells were grown in each well of six-well plates. The monolayer cells were transfected i.a s m 196 with 2 μg of empty vector or 2 μg of Flag-2B expressing plasmid using Lipofectamine .o r g / 197 2000, or infected with FMDV (MOI 0.05). The supernatants were collected, and the o n A 198 adherent cells were detached with trypsin, which did not contain EDTA and Phenol p r il 3 199 Red, at 24 hpt. The detached cells and supernatants were mixed, and the whole cells , 2 0 200 were collected. The collected cells were washed with PBS and resuspended in diluted 1 9 b 201 binding buffer at a density of 1×106 cells/mL. Flow cytometry was used to assess loss y g u e 202 of membrane asymmetry and integrity by AnnV-PI staining as described s t 203 previously(30). Surface exposure of phosphatidylserine on apoptotic cells was 204 detected by AnnV-FITC staining. PI binds with DNA in late apoptotic cells and 205 necrotic cells. 206 10