loading

Logout succeed

Logout succeed. See you again!

ebook img

DTIC ADA385975: Alterations in Inflammatory Cytokine Gene Expression in Sulfur Mustard-Exposed Mouse Skin PDF

pages13 Pages
file size1.2 MB
languageEnglish

Preview DTIC ADA385975: Alterations in Inflammatory Cytokine Gene Expression in Sulfur Mustard-Exposed Mouse Skin

Form Approved REPORT DOCUMENTATION PAGE OMB No. 0704-0188 Public reporting burden for this collection of information is estimated to average 1 hour per response, including the time for reviewing instructions, searching existing data sources, gathenng and maintaining the data needed, and completing and reviewing this collection of information. Send comments regarding this burden estimate or any other aspect of this collection of information, including suggestions for reducing this burden to Department of Defense, Washington Headquarters Services, Directorate for Information Operations and Reports (0704-0188), 1215 Jefferson Davis Highway, Suite 1204, Arlington, VA 22202- 4302. Respondents should be aware that notwithstanding any other provision of law, no person shall be subject to any penalty for falling to comply with a collection of Information If It does not display a currently valid OMB control number. PLEASE DO NOT RETURN YOUR FORM TO THE ABOVE ADDRESS. 1. REPORT DATE (DD-MM-YYYY) 2. REPORT TYPE 3. DATES COVERED (From ■ To) 2000 Open Literature 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Alterations in Inflammatory Cytokine Gene Expression in Sulfur Mustard-exposed Mouse Skin Sb. GRANT NUMBER DAAL30-C-91-10034 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER Sabourin, C.L.K., Petrali, J.P., and Casillas, R.P. 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION REPORT NUMBER Division of Environ. Health USAMRICD Sciences, School of Public ATTN: MCMR-UV-CC USAMRICD-P00-011 Health, Ohio State 5100 Ricketts Point Road University, Columbus, OH Aberdeen Proving Ground, MD AND 21010-5400 9. SPONSORING / MONITORING AGENCY NAME(S) AND ADDRESS(ES) 10. SPONSOR/MONITOR'S ACRONYM(S) US Army Medical Research Aberdeen Proving Ground, MD Institute of Chemical Defense 21010-5400 ATTN: MCMR-UV-RC 11. SPONSOR/MONITOR'S REPORT 3100 Ricketts Point Road NUMBER(S) 12. DISTRIBUTION / AVAILABILITY STATEMENT Approved for public release; distribution unlimited 13. SUPPLEMENTARY NOTES Published in Journal of Biochemistry and Molecular Toxicology, 14(6), 291-301, 2000 14. ABSTRACT See reprint. 20001226 076 15. SUBJECT TERMS sulfur mustard (HD), bis(2-chloroethyl)sulfide, skin, inflammation, mouse, cytokine, gene expression, RT-PCR, immunohistochemistry, in vivo, animal model 16. SECURITY CLASSIFICATION OF: 17. LIMITATION 18. NUMBER 19a. NAME OF RESPONSIBLE PERSON OF ABSTRACT OF PAGES John P. Petrali a. REPORT b. ABSTRACT c. THIS PAGE UNLIMITED 11 19b. TELEPHONE NUMBER (include area UNCLASSIFIED UNCLASSIFIED UNCLASSIFIED code) 410-436-2334 Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std. Z39.18 J BIOCHEM MOLECULAR TOXICOLOGY Volume 14, Number 6, 2000 Alterations in Inflammatory Cytokine Gene Expression in Sulfur Mustard-Exposed Mouse Skin Carol L. K. Sabourin,1 John P. Petrali,2 and Robert P. Casillas2 'Division of Environmental Health Sciences, School of Public Health, The Ohio State University, Columbus, OH 43210 2United States Army Medical Research Institute of Chemical Defense, Aberdeen Proving Ground, MD 21010 Received 2 February 2000; revised 30 May 2000; accepted 5 June 2000 ABSTRACT: Cutaneous exposure to sulfur mustard matory cytokines following cutaneous HD exposure. (bis(2-chloroethyl) sulfide, HD), a chemical warfare An understanding of the in vivo cytokine patterns fol- agent, produces a delayed inflammatory skin response lowing HD skin exposure may lead to defining the and severe tissue injury. Despite defined roles of in- pathogenic mechanisms of HD injury and the devel- flammatory cytokines produced or released in re- opment of pharmacological countermeasures. © 2000 sponse to skin-damaging chemicals, in vivo cytokine John Wiley & Sons, Inc. J Biochem Mol Toxicol 14:291- responses associated with HD-induced skin pathogen- 302, 2000 esis are not well understood. Additionally, there is lit- tle information on the in vivo temporal sequence of KEY WORDS: Sulfur Mustard (HD); Bis(2-chloro- gene expression of cytokines postexposure to HD. The ethyDsulfide; Skin; Inflammation; Mouse; Cytokine; goal of these studies was to identify in vivo molecular Gene Expression; RT-PCR; Immunohistochemistry; In biomarkers of HD skin injury within 24 hours after Vivo; Animal Model HD challenge. Gene expression of interleukin Iß (IL- lß), granulocyte-macrophage colony stimulating factor (GM-CSF), interleukin 6 (IL-6), and interleukin la (IL- INTRODUCTION la) in the mouse ear vesicant model was examined by quantitative reverse transcription-polymerase chain reaction (RT-PCR). An increase in IL-lß mRNA levels Sulfur mustard (bis(2-chloroethyl)sulfide, HD) was first observed at 3 hours. IL-lß, GM-CSF, and IL-6 produces incapacitating injury to the skin of exposed mRNA levels were dramatically increased at 6-24 individuals. However, cutaneous exposure to HD does hours postexposure. IL-la mRNA levels were not in- not cause immediately noticeable effects. Onset and se- creased following HD exposure. Immunohistochemi- verity of skin injury is dependent on dose, skin mois- cal studies demonstrated that IL-lß and IL-6 protein ture, body site, and ambient temperature. Erythema was produced at multiple sites within the ear, includ- appears within a few hours of exposure followed by ing epithelial cells, inflammatory cells, hair follicles, edema and blister formation [1]. Histopathologically, sebaceous glands, the dermal microvasculature, smooth muscle, and the dermal connective tissue. An cutaneous exposure to HD in animal or man is char- increase in the intensity of staining for IL-lß and IL-6 acterized by edema, dermal infiltration of inflamma- was observed in localized areas at 6 hours and was tory cells, premature death of basal layer epidermal evident in multiple areas at 24 hours. Positive staining cells, and epidermal-dermal separation [2-10]. Al- for GM-CSF immunoreactive protein was localized to though cutaneous histopathological markers are useful the inflammatory cells within the dermis. The number endpoints of HD exposure, the role of inflammatory of immunostaining cells was increased as early as 1 mediators produced prior to this endpoint is important hour following HD exposure. These studies document for a better understanding of the mechanism(s) of ac- an early increase in the in vivo expression of inflam- tion of HD. In previous studies, we observed an inflammatory Correspondence to: Dr. Robert Casillas. Present address: Battelle Memorial Institute, 505 King Avenue, Columbus, OH 43201-2693; response in the mouse ear following topical exposure Tel: 614-424-5102; Fax: 614-424-3317; E-mail: [email protected] with liquid HD [11]. Histopathologically, the mouse Contract Grant Sponsor: United States Army Medical Research ear vesicant model (MEVM) produced a mild inflam- Institute of Chemical Defense. matory infiltrate similar to what is seen in human skin Contract Grant Number: DAAL30-C-91-0034. [9]. The MEVM provides quantification of the cutane- A portion of this work was presented at the 37th Annual Meet- ing of the Society of Toxicology, March 1998. ous inflammatory response following HD exposure by © 2000 John Wiley & Sons, Inc. measuring ear swelling. Further studies using the 291 292 SABOURIN, PETRALI, AND CASILLAS Volume 14, Number 6, 2000 MEVM identified the in vivo production of the cyto- marked for identification and anesthetized with a com- kine interleukin 6 (IL-6) protein in cutaneous tissue bination of ketamine (60 mg/kg) and xylazine (12 mg/ from the ear [12]. The goal of the current study was to kg) by intraperitoneal injection. In a fume hood, a sin- utilize the MEVM to identify in vivo biological mark- gle application of 5 uL of 390 mM HD (0.32 mg) in ers for quick and accurate assessment of HD-induced dichloromethane was applied to the inner surface of skin injury, which may be used to corroborate nonin- the right ear according to published procedures [11]. vasive endpoints and histopathological alterations. This volume of HD allowed even distribution of agent The identification and characterization of the cellular over the entire medial surface of the ear. The left ear products that regulate the activation and migration of (vehicle control) was only exposed to 5 \iL of dichlo- inflammatory cells into the dermis and potentially re- romethane. Animals were housed individually after sult in the destruction of basal epidermal cells will pro- HD challenge, and cages were placed on warm water- vide insights into the selective targeting of medical perfused heating pads within the laboratory fume countermeasures against these processes. hood system. At 1, 3, 6, 12, 18, and 24 hours post-HD Cytokines are known to play a major role in acute challenge, animals were euthanized in a halothane- and chronic inflammation. Furthermore, granulocyte- filled chamber. Both ears (1 HD-exposed and 1 vehicle macrophage colony stimulating factor (GM-CSF), in- control ear) were collected from two animals per time terleukin 1 (IL-1), and IL-6 are known to act through a period. Each ear tissue was then bisected into two por- network in various biological processes including cell tions. One portion of each ear tissue was immediately growth and differentiation, immunoregulation, and in- fixed in 10% neutral buffered formalin, rinsed in PBS, flammation. In vivo studies have demonstrated that processed, and then embedded in paraffin blocks. The GM-CSF and IL-1 a induce the directed migration of other portion was immediately snap frozen in liquid neutrophils [13-15]. Few studies with in vivo HD skin nitrogen and stored at -80°C for RNA isolation. models, including those conducted in our laboratory, have demonstrated the presence or addressed the role RNA Isolation of inflammatory cytokines following direct cutaneous damage from HD [12,16]. Other investigators have Total cellular RNA was isolated from previously shown that sulfur mustard does induce soluble cyto- frozen tissues by using TRIzol Reagent (Life Technol- kine responses in ex vivo skin models [17-19] and in ogies, Gaithersburg, MD). Tissue was homogenized vitro in human keratinocytes [20-23]. In this study we with TRIzol using a polytron homogenizer. PhaseLock identified individual inflammatory cytokines and the Gel (5 Prime 3 Prime, Inc., Boulder, CO) was used dur- temporal sequence of their expression in vivo in mouse ing centrifugation to allow separation of the phenol- ear skin exposed to HD. IL-lß, GM-CSF, IL-6, and IL- chloroform phase from the aqueous phase. The aque- la gene expression was examined by quantitative re- ous phase was transferred to a fresh tube, and verse-transcription polymerase chain reaction (RT- isopropanol was added to precipitate the RNA. The PCR), and protein expression was localized by sample was centrifuged, and the pellet washed with immunohistochemistry. The expression of these me- 75% ethanol. The RNA pellet was dissolved in 100 uL diators will be used for the continued development of of diethyl pyrocarbonate (DEPC) treated water. To re- quantifiable in vivo biological markers in response to duce the percentage of contaminating DNA, a second HD injury and to evaluate the effectiveness of medical RNA extraction using TRIzol reagent was performed. countermeasures. 900 uL of TRIzol reagent was added to the 100 (iL of RNA sample, and the extraction was repeated. The fi- nal RNA pellet was resuspended in 50 uL of DEPC- treated water. RNA was quantitated spectrophotomet- MATERIALS AND METHODS rically based an absorbance at 260 nm of 1 equal to an RNA concentration of 40 ng/mL. The RNA samples HD Cutaneous Exposure were analyzed for integrity of 18S and 28S ribosomal Male CD1 mice, approximately four weeks of age, RNA (rRNA) by ethidium bromide staining of 1.0 |ag were purchased from Charles River Laboratories (Ra- of RNA resolved by electrophoresis on a 1.0% agarose leigh, NC) and housed in a controlled environment gel in Tris-borate-EDTA (45 mM Tris-borate, pH 8.0,1 with a 12 hour light/dark cycle. Purina Certified Ro- mM EDTA). dent Chow and water was available ad libitum. Ani- mals were maintained under an Association for As- RT-PCR sessment and Accreditation of Laboratory Animal Care (AAALAC) International program. On the study RNA was incubated at 60°C for 10 minutes and day, mice weighing in the range of 25-35 g were chilled to 4°C immediately before being reverse-tran- Volume 14, Number 6, 2000 CYTOKINES IN SULFUR MUSTARD-EXPOSED SKIN 293 TABLE 1. Primer Sequences Primer'' Sequence Nucleotides' Fragment Cycles IL-lß S 5'ATGGCAACTGTTCCTGAACTCAACT3' 78-102 563 bp 30 IL-lßAS 5'CAGGACAGGTATAGATTCTTTCCTTT3' 615-640 GM-CSF S 5"TGTGGTCTACAGCCTCTCAGCAC3' 64-86 368 bp 35 GM-CSF AS 5'CAAAGGGGATATCAGTCAGAAAGGT3' 407-431 IL-6S 5'ATGAAGTTCCTCTCTGCAAGAGACT3' 34-57 638 bp 38 IL-6 AS 5'CACTAGGTTTGCCGAGTAGATCTC3' 648-671 IL-la S 5 AAG ATGTCCAACTTCACCTTCAAGGAGAGCCG3' 241-272 491 bp 30 IL-la AS 5'AGGTCGGTCTCACTACCTGTGATGAGTTTTGG3' 700-731 HPRTS 5'GTAATGATCAGTCAACGGGGGAC3' 404-426 177 bp 29 HPRT AS 5'CCAGCAAGCTTGCAACCTTAACCA3' 557-580 "IL, interleukin; GM-CSF, granulocyte-macrophage colony stimulating factor; HPRT, hypoxanthine-guanine phosphoribosyltransferase. 'S, sense; AS, antisense. rNucleotide position according to GenBank sequence. scribed. Reverse transcription of 4 ng of total RNA was using the PCR MIMIC Construction Kit (Clontech) ac- performed in a volume of 40 \iL containing 100 units cording to the manufacturer's instructions with the of SuperScript II RNase H" Reverse Transcriptase (Life composite primers HPRT Sense 5'-CTAATGATCAG- Technologies), 10 mM Tris HC1, pH 8.3, 50 mM KC1, 5 TCAACGGGGGACGCAGATGAGTATCTTGTCCC-3' mM MgCl,1 unit/nL RNasin (Promega Corp., Madi- and HPRT Antisense 5'-CCAGCAAGCTTGCAACCT- 2 son, WI), 1 mM each of dATP, dGTP, dCTP, and dTTP, TAACCAATTTGATTCTGGACCATGGC-3'. Competi- and 200 pmol of random hexamers (Life Technologies) tive PCR was carried out to quantitate the relative for 60 minutes at 37°C. The samples were incubated for changes in mRNA. The appropriate range of PCR 10 minutes at 25°C before transcription and heated to MIMIC was determined using 10-fold dilutions of the 99°C for 5 minutes to terminate the reverse transcrip- PCR MIMIC. PCR was then performed with reverse tion reaction. transcribed RNA, containing five to seven 2-fold di- By using a Perkin-Elmer DNA Thermocycler 9600 lutions of PCR MIMIC. Aliquots were electrophoresed (Perkin-Elmer, Norwalk, CT), 2 uL of cDNA mixture on a 1.8% agarose gel in Tris-borate-EDTA and stained obtained from the reverse transcription reaction was with ethidium bromide. A CCD image sensor (Alpha amplified for the specific genes. The amplification re- Innotech Corporation, San Leandro, CA) measured the action mixture consisted of 10 mM Tris HC1, pH 8.3; intensity of ethidium bromide luminescence. A log-log 50 mM KC1; 2.5 mM MgCl 0.2 mM each of dATP, plot of the ratio of cytokine target peak area to cytokine 2; dGTP, dCTP, and dTTP; 0.25 uM each of sense and an- MIMIC peak area versus the molar amount of cytokine tisense primers; and 0.625 units of Taq DNA polymer- MIMIC added to the PCR reaction was constructed. ase (Life Technologies) in a final volume of 25 |iL. The Linear regression analysis was performed. The molar Taq DNA polymerase was preincubated with TaqStart amount of cytokine target cDNA from the reverse tran- antibody (Clontech, Palo Alto, CA) for 5 minutes at scribed RNA was determined from the intersection of room temperature. Water and reverse transcriptase mi- the curve with a ratio of 1.0 to the x-axis. The mRNA nus reactions were run as negative controls. The reac- level of cytokine was expressed in attomol/ug RNA. tion mixture was first heated at 95°C for 30 seconds, A similar analysis was performed for HPRT. The at- and amplification was at 95°C for 15 seconds, 60°C for tomol/ug of each cytokine was normalized to the at- 30 seconds, and 72CC for 30 seconds, followed by in- tomol/ug of HPRT. cubation for 7 minutes at 72CC. The PCR primers and fragment sizes are listed in Table 1. The PCR products Immunohistochemical Staining were electrophoresed through a 1.8% agarose gel in Tris-borate-EDTA buffer and stained with ethidium Skin specimens collected from two animals (one bromide. HD-exposed and one vehicle-control-exposed site per animal) per time period for six time periods (1,3, 6,12, 18, and 24 hours) were used for immunohistochemical Quantitative PCR Analysis evaluation. Paraffin-embedded tissue sections (5 |iM PCR MIMICs for mouse IL-lß, GM-CSF, IL-6, and each) were deparaffinized and rehydrated. Endoge- IL-la were purchased from Clontech (Palo Alto, CA). nous peroxidase activity was ablated with 1% hydro- A PCR MIMIC for mouse hypoxanthine-guanine gen peroxide in PBS. Tissue sections were washed in phosphoribosyltransferase (HPRT) was constructed PBS. GM-CSF immunostained tissue sections were in- 294 SABOURIN, PETRALI, AND CASILLAS Volume 14, Number 6,2000 Left Ear - Control Right Ear - Treated 1 13 3 6 6 12 12 18 18 24 24 11 3 3 6 6 12 12 18 18 24 24 VV RT RT M • 563 bp IL-l|i B 160 140 120 100 80 60 40 20 0 1 3 Time (hours) FIGURE 1. IL-lß gene expression in control and HD-exposed mouse ear from 1 to 24 hours postexposure. RNA was isolated from vehicle- control-treated (dichloromcthane) and HD-treated mouse ear. RNA was reverse transcribed followed by amplification of cytokine cDNA. (A) The PCR product was loaded onto a 1.8% agarose gel, resolved by electrophoresis, and visualized by staining with ethidium bromide. RT , no reverse transcriptase; W, water control; and M, 100 base pair marker. (B) Analysis of relative changes in IL-lß mRNA levels determined by competitive PCR. Aliquots of cDNA were amplified in presence of 2-fold dilutions of IL-lß MIMICs. After PCR was performed, aliquots were electrophoresed on a 1.8% agarose gel. The peak areas of the bands corresponding to the IL-lß mRNA in mouse skin and IL-lß MIMICs were determined by image analysis. Attomol/ug RNA for IL-lß was determined as detailed in the Materials and Methods. Attomol/ug for IL-lß was normalized to the attomol/ug for the housekeeping gene HPRT for each sample. HD-treated skin normalized IL-lß levels were divided by the dichloromethane-treated skin normalized IL-lß levels. The average of two separate determinations was plotted for the 24 hour time course. cubated with 0.1% trypsin (bovine pancreas type III, tor Laboratories). Color was developed with 3,3'-di- Sigma, St. Louis, MO) for 30 minutes at 37°C and sub- aminobenzidine tetrahydrochloride (DAB) as the sub- sequently washed three times with PBS. PBS contain- strate. The sections were counterstained with Harris' ing 10% normal rabbit serum (GM-CSF and IL-6) or acid hematoxylin (Shandon, Pittsburgh, PA). To dem- 10% normal goat serum (IL-lß) was used to suppress onstrate specificity of the immunostaining, the pri- nonspecific protein binding. Tissue sections were in- mary antibodies were replaced with similar protein cubated overnight at 4°C with the primary antibodies concentrations of antibody neutralized with the recom- monoclonal rat anti-mouse GM-CSF, polyclonal rabbit binant cytokines (Genzyme) at 37°C, and no primary anti-mouse IL-lß, or monoclonal rat anti-mouse IL-6 antibody. Slides were evaluated by light microscopy, (Genzyme, Cambridge, MA). The sections were and representative areas were photographed. washed with PBS and incubated with biotinylated rab- bit anti-rat IgG (GM-CSF and IL-6) or goat anti-rabbit RESULTS IgG (IL-lß), (Vector Laboratories, Burlingame, CA) at Quantitative RT-PCR Analysis: Effect of a dilution of 1:100 for 30 minutes at room temperature. After washing, the sections were incubated with avi- HD on Cytokine Gene Expression din-biotin peroxidase complex at room temperature Studies were performed to determine the time de- for 30 minutes using the Vectastain Elite ABC kit (Vec- pendence of induction of inflammatory cytokine gene Volume 14, Number 6, 2000 CYTOKINES IN SULFUR MUSTARD-EXPOSED SKIN 295 A Left Ear - Control Right Ear - Treated 113 3 6 6 12 12 18 18 24 24 113 3 6 6 12 12 18 18 24 24 WRTRTM - 368 bp GM-CSF B 6 12 Time (hours) FIGURE 2. GM-CSF gene expression in control and HD-exposed mouse ear from 1 to 24 hours postexposure. RNA was isolated from vehicle- control-treated (dichloromethane) and HD-treated mouse ear. RNA was reverse transcribed followed by amplification of cytokine cDNA. (A) The PCR product was loaded onto a 1.8% agarose gel, resolved by electrophoresis, and visualized by staining with ethidium bromide. RT~, no reverse transcriptase; W, water control; and M, 100 base pair marker. (B) Analysis of relative changes in GM-CSF mRNA levels determined by competitive PCR. Aliquots of cDNA were amplified in presence of 2-fold dilutions of GM-CSF MIMICs. After PCR was performed, aliquots were electrophoresed on a 1.8% agarose gel. The peak areas of the bands corresponding to the GM-CSF mRNA in mouse skin and GM-CSF MIMICs were determined by image analysis. Attomol/ng RNA for GM-CSF was determined as detailed in Materials and Methods. Attomol/ Hg for GM-CSF was normalized to the attomol/ug for the housekeeping gene HPRT for each sample. HD-treated skin normalized GM-CSF levels were divided by the dichloromethane-treated skin normalized GM-CSF levels. The average of two separate determinations was plotted for the 24 hour time course. expression over a time period of 1-24 hours in CD1 following a single application of 5 (iL of 390 mM HD mouse ears following topical HD exposure. IL-lß, GM- in dichloromethane on the inner surface of the ear. IL- CSF, IL-6, and IL-la gene expression was examined by 1 ß mRNA levels were moderately increased from con- RT-PCR to establish the in vivo cytokine pattern (Fig- trol levels at 3 hours postexposure to HD (Figure 1), ures 1-4A). Amplification of HPRT was similar in tis- however, there was an increase of greater than 100-fold sue from control and HD-exposed mouse ear at all time at 6 hours compared to control levels. GM-CSF mRNA periods (Figure 5A). Quantitation of the relative levels were increased 10-fold from control levels at 6 changes in gene expression for cytokines and HPRT hours postexposure to HD and were increased 40-fold was accomplished by competitive PCR using PCR at 24 hours (Figure 2). An IL-6 PCR product was first MIMICs as illustrated for HPRT (Figure 5B and C). observed at 6 hours postexposure to HD with no fur- Gene expression in control mouse ear was detect- ther increase in the IL-6 mRNA levels from 6 to 24 able for all inflammatory cytokines except IL-6. In HD- hours (Figure 3). IL-la mRNA levels were relatively exposed ears, a time-dependent increase in IL-lß, GM- unaltered over the time period of 1-24 hours following CSF, and IL-6 mRNA levels (Figures 1-3) was observed topical treatment with HD (Figure 4). 296 SABOURIN, PETRALI, AND CASILLAS Volume 14, Number 6.2000 Left Ear - Control Right Ear - Treated 3 3 6 6 12 12 18 18 24 24 11 3 3 6 6 12 12 18 18 24 24 VV RT RT M • 638 bp IL-6 B 35 30 QX 25 ">5 20 i' < z 15 E 10 5 0 6 12 18 24 Time (hours) FIGURE 3. IL-6 gene expression in control and HD-exposed mouse ear from 1 to 24 hours postexposure. RNA was isolated from vehicle- control-treated (dichloromethanc) and HD-treated mouse ear. RNA was reverse transcribed followed by amplification of cytokinc cDNA. (A) The PCR product was loaded onto a 1.8% agarose gel, resolved by electrophoresis, and visualized by staining with ethidium bromide. A PCR product for IL-6 was not detected in dichloromethane-treated skin. RT , no reverse transcriptase; W, water control; and M, 100 base pair marker. (B) Analysis of IL-6 mRNA levels determined by competitive PCR. Aliquots of cDNA were amplified in presence of 2-fold dilutions of IL-6 MIMICs. After PCR was performed, aliquots were electrophoresed on a 1.8% agarose gel. The peak areas of the bands corresponding to the IL-6 mRNA in mouse skin and IL-6 MIMICs were determined by image analysis. Attomol/ng RNA for IL-6 was determined as detailed in Materials and Methods. Attomol/ug for IL-6 was normalized to the attomol/jig for the housekeeping gene HPRT for each sample. The average of two separate determinations was plotted for the 24 hour time course. Immunohistochemkal Localization of protein in multiple areas at 24 hours posttreatment Cytokine Expression with HD (Figure 6A and B). Immunostaining of GM-CSF over the 24 hour time Immunohistochemical studies were performed to course was localized to the dermal inflammatory cells. identify the cell types within the epidermis and dermis In general, few cells stained positive in the control ears. that produced the cytokines in response to topical ap- An increase in the number of inflammatory cells stain- plication of HD over the 24 hour time course. Immu- ing positive for GM-CSF was observed beginning at 1 nostaining of IL-lß was localized to multiple sites hour post-HD challenge and continued throughout within the ear including epithelial cells, inflammatory the time course. Figure 6C and D illustrates the pattern cells, adnexal structures (hair follicles and sebaceous of cells staining for GM-CSF immunoreactive protein glands), the dermal microvasculature, smooth muscle, and the dermal connective tissue. Staining was similar compared to control at the 6 hour time point. in control and HD-exposed mouse ears at 1 and 3 Immunostaining of IL-6 was localized to multiple hours. Beginning at 6 hours postexposure, localized ar- sites within the ear, including epithelial cells, inflam- eas with increased IL-lß immunostaining were ob- matory cells, adnexal structures (hair follicles and se- served in the HD-treated ears. The cutaneous tissue baceous glands), the dermal microvasculature, smooth showed intense staining for IL-lß immunoreactive muscle, and the dermal connective tissue. Staining was Volume 14, Number 6, 2000 CYTOKINES IN SULFUR MUSTARD-EXPOSED SKIN 297 Left Ear - Control Right Ear - Treated A h 113 3 6 6 12 12 18 18 24 24 1 13 3 6 6 12 12 18 18 24 24 W RT RT M -491 bp IL-la B 2 n 1.8 1.6 1.4 K 2 12 ES 1 H S 0.8 S> ! 0.6 ■I H■ 0.4 0.2 0 Time (hours) FIGURE 4. IL-la gene expression in control and HD-exposed mouse ear from 1 to 24 hour postexposure. RNA was isolated from vehicle- control-treated (dichloromethane) and HD-treated mouse ear. RNA was reverse transcribed followed by amplification of cytokine cDNA. (A) The PCR product was loaded onto a 1.8% agarose gel, resolved by electrophoresis, and visualized by staining with ethidium bromide. RT", no reverse transcriptase; W, water control; and M, 100 base pair marker. (B) Analysis of relative changes in IL-la mRNA levels determined by competitive PCR. Aliquots of cDNA were amplified in presence of 2-fold dilutions of IL-la MIMICs. After PCR was performed, aliquots were electrophoresed on a 1.8% agarose gel. The peak areas of the bands corresponding to the IL-la mRNA in mouse skin and IL-la MIMICs were determined by image analysis. Attomol/ng RNA for IL-la was determined as detailed in Materials and Methods. Attomol/ug for IL-la was normalized to the attomol/ug for the housekeeping gene HPRT for each sample. HD-treated skin normalized IL-la levels were divided by the dichloromethane-treated skin normalized IL-la levels. The average of two separate determinations was plotted for the 24 hour time course. similar in control and HD-exposed mouse ears at early skin exposed to HD. Furthermore, these data demon- time points, however, at 6 hours, staining intensity was strate that damage to the skin by HD results in an im- increased in the HD-exposed ear. The epithelium of the munological response characterized by specific and in- HD-treated ear showed intense staining for IL-6 im- creased cytokine gene expression. These cytokines are munoreactive protein at 24 hours (Figure 6E and F). known to function in maintaining cutaneous homeo- stasis and play a key role in the pathogenesis of a num- ber of dermatological diseases [24-27]. GM-CSF and DISCUSSION IL-1 act as potent chemoattractant factors, either di- rectly or by stimulating the production of chemokines This study defined the temporal sequence of gene that recruit inflammatory leukocytes to sites of inflam- expression of the inflammatory cytokines IL-lß, GM- mation [14,28,29]. IL-1 can induce the expression of ad- CSF, IL-6, and IL-la following a single topical expo- hesion molecules, including intercellular adhesion sure to HD. These data document for the first time the molecule-1 (ICAM-1) on the surface of vascular endo- use of quantitative RT-PCR and immunohistochemis- thelial cells [14,28]. Cutaneous production of these cy- try to establish an in vivo cytokine pattern in mouse tokines in response to HD-induced injury suggests 298 SABOURIN, PETRALI, AND CASILLAS Volume 14, Number 6, 2000 Left Ear - Control Right Ear - Treated A li 113 3 6 6 12 12 18 18 24 24 11 3 3 6 6 12 12 18 18 24 24 W M - 177 bp HPRT B Left Ear - Control 1 h I .eft Ear - Control 3h abedefabedef 273 bp MIMIC 177 bp HPRT 10.0 0.01 0.1 HPRT MIMIC, attomol FIGURE 5. (A) HPRT gene expression in control and HD-exposed mouse ear from 1 to 24 hour postexposurc. RNA was isolated from vehicle- control-treated (dichloromcthane) and HD-treated mouse ear. RNA was reverse transcribed followed by amplification of cytokinc cDNA. The PCR product was loaded onto a 1.8% agarose gel, resolved by electrophoresis, and visualized by staining with ethidium bromide. RT , no reverse transcriptase; W, water control; and M, 100 base pair marker. (B) Competitive PCR analysis of changes in HPRT mRNA levels in mouse ear control samples at 1 and 3 hours. PCR was carried out using 0.1 ug of reverse-transcribed total RNA in the presence of 2-fold dilutions of HPRT MIMIC. The PCR products were resolved on a 1.8% agarose gel and stained with ethidium bromide. The HPRT target was 177 bp (lower band), and the HPRT MIMIC was 273 bp (upper band). The following amounts of HPRT MIMIC were used in the reaction: 5.0 X 10 ' attomol, lane a; 2.5 X 10-' attomol, lane b; 1.25 X 10 ' attomol, lane c; 6.25 X 10 2 attomol, lane d; 3.12 x 10 2 attomol, lane e; and 1.56 X 10 2 attomol, lane f. M, 100 bp marker. (C) Graphic analysis of the quantitative PCR analysis shown in B. The peak area of the electrophoretic bands was measured by image analysis. The closed and open circles denote data derived from 1 h and 3 hour control ear samples, respectively. The ratio of the target to MIMIC area was plotted against the attomol of HPRT MIMIC added to the PCR reaction. Lines were drawn based on a linear regression analysis of six data points. Left ear control for 1 hour was 0.035 attomoI/0.1 ug RNA and left ear control for 3 hours was 0.027 attomol/0.1 ug RNA. Volume 14, Number 6, 2000 CYTOKINES IN SULFUR MUSTARD-EXPOSED SKIN 299 *n#>-.-.'; -,« %'"W •- »>,ÄJt» tei8^#~iBP,i!- . ■^■''"L+j^*.- J-''.\, *■** . Air1*. -• * nay v r* i »< » ■ .■*■• • **■• **. * t » C . Jä*^ r^ Ä 'f »> ••■%" 'i?0 Äfffs''; * »*. P* " ****»2#Ä. «' .. ... *^ **•- m*** 7 JC% « ttf^L *QR ■i'#! ■ if W \ i r\'X>- /' At ■■•*'' >^ ■#.----:«. « ,' ,n ■sir *~-*.f\ M'^fs ■■*' ..rf*«^!^ FIGURE 6. Immunohistochemical localization of protein for IL-lß in dichloromethane-treated (A) and HD-treated (B) mouse ear at 24 hours posttreatment; GM-CSF in dichloromethane-treated (C) and HD-treated mouse ear (D) at 6 hours posttreatment; and IL-6 in dichloromethane- treated (E) and HD-treated (F) mouse ear at 24 hours posttreatment. (A and B) IL-lß immunoreactive protein was localized to multiple sites, including epithelial cells, inflammatory cells, hair follicles, sebaceous glands, the dermal microvasculature, smooth muscle, and the dermal connective tissue. Immunostaining was light to moderate in control ear. HD-treatment resulted in increased IL-lß immunoreactive protein at 24 hours. Arrows indicate positive staining lymphocytes. CA, cartilage; SBG, sebaceous gland. Magnification 20X. (C and D) GM-CSF immu- noreactive protein was localized to the inflammatory cells. An increase in the number of inflammatory cells containing immunoreactive GM- CSF protein in the HD-treated ear compared to the dichloromethane-treated ear was first observed at 1 hour posttreatment. Arrows indicate examples of positive-staining neutrophils. CA, cartilage. Magnification 20X. (E and F) IL-6 immunoreactive protein was localized to multiple sites including epithelial cells, inflammatory cells, hair follicles, sebaceous glands, the dermal microvasculature, smooth muscle, and the dermal connective tissue. Immunostaining was light to moderate in dichloromethane-treated mouse ear. HD treatment resulted in increased IL-6 immunoreactive protein at 24 hours. Large arrows indicate areas of epithelial degeneration, cytoplasmic staining of epithelial cells, elobulation of superior epithelial cells, and fibroblast staining. CA, cartilage; HF, hair follicle. Magnification 20X.

See more

The list of books you might like