Logout succeed
Logout succeed. See you again!

Download Green Anarchy #11 pdf PDF
Preview Download Green Anarchy #11 pdf
EE ff ff ii cc ii ee nn cc yy E f f i c i e n c y by Jesus Sepulveda “The Garden Of Peculiarities” Part 4 from Efficiency is inflexible. An automatic collector construct categories that operate with the logic of on the bus processes only exact change to print a taxonomic standardization. Thus it differentiates ticket; otherwise, it does not work, and it invalidates and creates sets while it negates the differences in the operation. The automatic teller buzzes at a these same sets, which cannot resist the light and wrong button pushed and rejects the plastic card. organicity of its own peculiarities. This is the logic of efficiency, or the reason of Reality is a garden of peculiarities forged from a inflexibility. In the same way, being indecisive is constellation of other peculiarities, which at the a sign of inefficiency, which marks and burns with same time disperse themselves in their own WWWWWhhhhheeeeerrrrreeeee WWWWWeeeee’’’’’rrrrreeeee AAAAAttttt the stain of the flexible. universe to the rhythm of the sap that flows and The sap that flows through nature spreads without flowers. The fluid does not organize itself nor does a stable base of identity. Rather it flows sponta- it represent itself. It is only a flow. Everything that AAAAAccccccccccooooorrrrrdddddiiiiinnnnnggggg tttttooooo OOOOOssssswwwwwaaaaalllllddddd SSSSSpppppeeeeennnnngggggllllleeeeerrrrr,,,,, “““““AAAAAbbbbbooooouuuuuttttt iiiiidddddeeeeeaaaaasssss pppppeeeeeooooopppppllllleeeee fffffiiiiiggggghhhhhttttt nnnnnooooo mmmmmooooorrrrreeeee..... TTTTThhhhheeeee lllllaaaaasssssttttt neously, precipitately. It does not reproduce inhabits it is part of its own organicity, which grows iiiiidddddeeeeeaaaaa ————— ttttthhhhhaaaaattttt ooooofffff ttttthhhhheeeee CCCCCiiiiivvvvviiiiillllliiiiizzzzzaaaaatttttiiiiiooooonnnnn iiiiitttttssssseeeeelllllfffff ————— iiiiisssss fffffooooorrrrrmmmmmuuuuulllllaaaaattttteeeeeddddd iiiiinnnnn ooooouuuuutttttllllliiiiinnnnneeeee,,,,, aaaaannnnnddddd ttttteeeeeccccchhhhhnnnnniiiiicccccsssss itself identically, and it rejects the molds of in the constant movement of each unique and aaaaannnnnddddd eeeeecccccooooonnnnnooooommmmmiiiiicccccsssss aaaaarrrrreeeee aaaaasssss ppppprrrrrooooobbbbbllllleeeeemmmmmsssss,,,,, eeeeennnnnuuuuunnnnnccccciiiiiaaaaattttteeeeeddddd aaaaannnnnddddd ppppprrrrreeeeepppppaaaaarrrrreeeeeddddd fffffooooorrrrr hhhhhaaaaannnnndddddllllliiiiinnnnnggggg.....””””” mechanization. unrepeatable constellation. The organicity of BBBBBuuuuuttttt ttttthhhhhiiiiisssss iiiiisssss tttttrrrrruuuuueeeee ooooonnnnnlllllyyyyy iiiiinnnnnsssssooooofffffaaaaarrrrr aaaaasssss ccccciiiiivvvvviiiiillllliiiiizzzzzaaaaatttttiiiiiooooonnnnn iiiiisssss eeeeexxxxxcccccllllluuuuudddddeeeeeddddd fffffrrrrrooooommmmm cccccooooonnnnnsssssiiiiidddddeeeeerrrrraaaaatttttiiiiiooooonnnnn..... This fluid is in constant movement. While the change—which sometimes expresses itself like FFFFFooooorrrrr uuuuusssss,,,,, iiiiittttt iiiiisssss aaaaannnnnyyyyyttttthhhhhiiiiinnnnnggggg bbbbbuuuuuttttt “““““ttttthhhhheeeee lllllaaaaasssssttttt iiiiidddddeeeeeaaaaa””””” ooooorrrrr aaaaannnnn aaaaacccccccccceeeeepppppttttteeeeeddddd fffffaaaaattttteeeee..... RRRRRaaaaattttthhhhheeeeerrrrr,,,,, ttttthhhhhooooossssseeeee wwwwwhhhhhooooo river runs, its particles have no possible replica. In bubbles in boiling water—surfaces when humans cccccooooonnnnnfffffrrrrrooooonnnnnttttt ccccciiiiivvvvviiiiillllliiiiizzzzzaaaaatttttiiiiiooooonnnnn tttttaaaaakkkkkeeeee aaaaa sssssttttteeeeeppppp aaaaasssss nnnnneeeeeccccceeeeessssssssssaaaaarrrrryyyyy aaaaasssss iiiiittttt iiiiisssss iiiiinnnnnssssspppppiiiiirrrrriiiiinnnnnggggg..... AAAAAnnnnntttttiiiii-----ccccciiiiivvvvviiiiillllliiiiizzzzzaaaaatttttiiiiiooooonnnnn this way, freezing a single drop, isolating it from concentrate their energy—which becomes self- ooooorrrrr aaaaannnnnaaaaarrrrrccccchhhhhooooo-----ppppprrrrriiiiimmmmmiiiiitttttiiiiivvvvviiiiisssssmmmmm iiiiisssss aaaaannnnn eeeeesssssssssseeeeennnnntttttiiiiiaaaaalllll rrrrreeeeennnnneeeeewwwwwaaaaalllll ooooofffff pppppaaaaassssssssssiiiiiooooonnnnn aaaaannnnnddddd vvvvviiiiisssssiiiiiooooonnnnn..... TTTTThhhhhiiiiisssss the general flow, is an act against nature. Cloning reflexive consciousness—and corrects the course pppppeeeeerrrrrssssspppppeeeeeccccctttttiiiiivvvvveeeee iiiiisssss iiiiinnnnn mmmmmaaaaannnnnyyyyy wwwwwaaaaayyyyysssss ttttthhhhheeeee bbbbbeeeeegggggiiiiinnnnnnnnnniiiiinnnnnggggg ooooofffff ttttthhhhheeeee fffffiiiiiggggghhhhhttttt,,,,, bbbbbaaaaassssseeeeeddddd ooooonnnnn aaaaannnnn aaaaawwwwwaaaaarrrrreeeeennnnneeeeessssssssss nature in order to pour its double into a test tube is of daily events. But organicity is also natural and ooooofffff hhhhhooooowwwww mmmmmuuuuuccccchhhhh iiiiisssss aaaaattttt ssssstttttaaaaakkkkkeeeee aaaaannnnnddddd hhhhhooooowwwww fffffaaaaarrrrr ttttthhhhheeeee fffffiiiiiggggghhhhhttttt mmmmmuuuuusssssttttt bbbbbeeeee tttttaaaaakkkkkeeeeennnnn..... a reifying act. Nature is peculiarity itself and is independent of consciousness. For example, global DDDDDiiiiivvvvviiiiisssssiiiiiooooonnnnn ooooofffff lllllaaaaabbbbbooooorrrrr aaaaannnnnddddd dddddooooommmmmeeeeessssstttttiiiiicccccaaaaatttttiiiiiooooonnnnn,,,,, pppppiiiiillllllllllaaaaarrrrrsssss ooooofffff ttttthhhhheeeee dddddoooooooooommmmmeeeeeddddd ccccciiiiivvvvviiiiillllliiiiizzzzzeeeeeddddd wwwwwooooorrrrrlllllddddd,,,,, fragile like every snowflake. Its spirit is flexible. warming, caused by human technology, will make mmmmmuuuuusssssttttt bbbbbeeeee ooooovvvvveeeeerrrrrtttttuuuuurrrrrnnnnneeeeeddddd,,,,, aaaaalllllooooonnnnnggggg wwwwwiiiiittttthhhhh pppppaaaaatttttrrrrriiiiiaaaaarrrrrccccchhhhhyyyyy,,,,, wwwwwhhhhhiiiiiccccchhhhh iiiiisssss fffffuuuuunnnnndddddaaaaammmmmeeeeennnnntttttaaaaallllllllllyyyyy sssssyyyyynnnnnooooonnnnnyyyyymmmmmooooouuuuusssss The logic of standardization articulates itself in- the planet cool down to counteract the frightening wwwwwiiiiittttthhhhh ccccciiiiivvvvviiiiillllliiiiizzzzzaaaaatttttiiiiiooooonnnnn..... TTTTThhhhhuuuuusssss wwwwweeeee aaaaarrrrreeeee nnnnneeeeeiiiiittttthhhhheeeeerrrrr DDDDDeeeeeeeeeeppppp EEEEEcccccooooolllllooooogggggiiiiissssstttttsssss nnnnnooooorrrrr “““““gggggrrrrreeeeeeeeeennnnn””””” llllleeeeeffffftttttiiiiissssstttttsssss,,,,, sssssiiiiinnnnnccccceeeee stead through the mechanisms of efficiency. An and artificial heat of fossil fuels. This will cause bbbbbooooottttthhhhh pppppaaaaarrrrrtttttiiiiieeeeesssss aaaaavvvvvoooooiiiiiddddd sssssuuuuuccccchhhhh bbbbbaaaaasssssiiiiiccccc ccccchhhhhaaaaalllllllllleeeeennnnngggggeeeeesssss..... experiment cannot make itself flexible, it requires floods, tsunamis and even the disappearance of AAAAAsssss 22222000000000033333 uuuuunnnnnfffffooooollllldddddsssss,,,,, aaaaa UUUUUSSSSS wwwwwaaaaarrrrr wwwwwiiiiittttthhhhh IIIIIrrrrraaaaaqqqqq ssssseeeeeeeeeemmmmmsssss iiiiimmmmmmmmmmiiiiinnnnneeeeennnnnttttt,,,,, wwwwwiiiiittttthhhhh IIIIIrrrrraaaaannnnn pppppooooossssssssssiiiiibbbbblllllyyyyy ttttthhhhheeeee a stable pattern that must be tested under inflexible coastal population centers. To not understand this nnnnneeeeexxxxxttttt tttttaaaaarrrrrgggggeeeeettttt..... EEEEEmmmmmpppppiiiiirrrrreeeee iiiiisssss nnnnnooooowwwww gggggoooooiiiiinnnnnggggg fffffooooorrrrr bbbbbrrrrroooookkkkkeeeee aaaaattttt hhhhhooooommmmmeeeee aaaaannnnnddddd aaaaabbbbbrrrrroooooaaaaaddddd,,,,, dddddeeeeessssspppppeeeeerrrrraaaaattttteeeee fffffooooorrrrr conditions and coordinates. Life flows in an is to alienate oneself from the course of life that dddddeeeeefffffiiiiinnnnniiiiitttttiiiiivvvvveeeee vvvvviiiiiccccctttttooooorrrrryyyyy..... RRRRReeeeeppppprrrrreeeeessssssssssiiiiiooooonnnnn aaaaannnnnddddd aaaaaggggggggggrrrrreeeeessssssssssiiiiiooooonnnnn iiiiinnnnncccccrrrrreeeeeaaaaassssseeeee,,,,, wwwwwhhhhhiiiiillllleeeee rrrrreeeeesssssiiiiissssstttttaaaaannnnnccccceeeee cccccooooonnnnntttttiiiiinnnnnuuuuueeeeesssss organic way, like the sap of plants, it is not a flows between each and every one of us. It is to tttttooooo bbbbbuuuuuiiiiilllllddddd aaaaabbbbbooooovvvvveeeee gggggrrrrrooooouuuuunnnnnddddd aaaaannnnnddddd bbbbbeeeeelllllooooowwwww ttttthhhhheeeee sssssuuuuurrrrrfffffaaaaaccccceeeee..... TTTTThhhhheeeee yyyyyeeeeeaaaaarrrrr aaaaahhhhheeeeeaaaaaddddd wwwwwiiiiillllllllll bbbbbrrrrriiiiinnnnnggggg uuuuusssss bbbbbooooottttthhhhh laboratory experiment under scientific control. On fall into reification, that is to say, into the logic bbbbbeeeeetttttttttteeeeerrrrr aaaaannnnnddddd wwwwwooooorrrrrssssseeeee tttttiiiiimmmmmeeeeesssss..... the contrary, it flowers with the flexibility of a bud. that situates subjects like dead matter in a control TTTTThhhhhrrrrreeeeeeeeee yyyyyeeeeeaaaaarrrrrsssss hhhhhaaaaavvvvveeeee pppppaaaaasssssssssseeeeeddddd sssssiiiiinnnnnccccceeeee ttttthhhhheeeee aaaaannnnntttttiiiii-----WWWWWTTTTTOOOOO “““““BBBBBaaaaattttttttttllllleeeee ooooofffff SSSSSeeeeeaaaaattttttttttllllleeeee.....””””” PPPPPrrrrraaaaaggggguuuuueeeee 22222000000000000000 Sap waters the world through each one of its panel. This is the panel that turns on and off the aaaaannnnnddddd ttttthhhhheeeee eeeeexxxxxppppplllllooooosssssiiiiiooooonnnnn ooooofffff GGGGGeeeeennnnnooooovvvvvaaaaa 22222000000000011111 fffffooooollllllllllooooowwwwweeeeeddddd,,,,, wwwwwiiiiittttthhhhh 99999/////1111111111 bbbbbrrrrriiiiinnnnngggggiiiiinnnnnggggg aaaaa ttttteeeeemmmmmpppppooooorrrrraaaaarrrrryyyyy peculiarities. Effi- mechanized system, negating sssssuuuuupppppppppprrrrreeeeessssssssssiiiiiooooonnnnn ooooofffff sssssiiiiimmmmmiiiiilllllaaaaarrrrrlllllyyyyy mmmmmiiiiillllliiiiitttttaaaaannnnnttttt oooooccccccccccaaaaasssssiiiiiooooonnnnnsssss..... WWWWWhhhhhaaaaattttt eeeeerrrrruuuuupppppttttteeeeeddddd iiiiinnnnn SSSSSeeeeeaaaaattttttttttllllleeeee hhhhhaaaaasssss nnnnnooooottttt ciency negates with its measured tic-tac the gggggooooonnnnneeeee aaaaawwwwwaaaaayyyyy,,,,, bbbbbuuuuuttttt cccccooooonnnnntttttiiiiinnnnnuuuuueeeeesssss tttttooooo dddddeeeeevvvvveeeeellllloooooppppp..... TTTTThhhhheeeeerrrrreeeee’’’’’sssss aaaaa sssssttttteeeeeaaaaadddddyyyyy mmmmmooooovvvvveeeeemmmmmeeeeennnnnttttt iiiiinnnnn ttttthhhhheeeee dddddiiiiirrrrreeeeeccccctttttiiiiiooooonnnnn nature, given that it permanent course of life. ooooofffff iiiiinnnnndddddiiiiiccccctttttiiiiinnnnnggggg ccccciiiiivvvvviiiiillllliiiiizzzzzaaaaatttttiiiiiooooonnnnn,,,,, iiiiinnnnncccccllllluuuuudddddiiiiinnnnnggggg cccccooooouuuuunnnnntttttllllleeeeessssssssss aaaaannnnntttttiiiii-----aaaaauuuuuttttthhhhhooooorrrrriiiiitttttaaaaarrrrriiiiiaaaaannnnn ppppprrrrrooooojjjjjeeeeeccccctttttsssss wwwwwooooorrrrrllllldddddwwwwwiiiiidddddeeeee..... tries to impose a control panel over NOTE: This is one part of TTTTThhhhheeeee llllleeeeefffffttttt,,,,, mmmmmeeeeeaaaaannnnnwwwwwhhhhhiiiiillllleeeee,,,,, cccccooooonnnnnfffffooooorrrrrmmmmmsssss tttttooooo SSSSSpppppeeeeennnnngggggllllleeeeerrrrr’’’’’sssss ooooobbbbbssssseeeeerrrrrvvvvvaaaaatttttiiiiiooooonnnnn ttttthhhhhaaaaattttt pppppeeeeeooooopppppllllleeeee nnnnnooooo forty-seven from the book lllllooooonnnnngggggeeeeerrrrr fffffiiiiiggggghhhhhttttt fffffooooorrrrr iiiiidddddeeeeeaaaaasssss..... TTTTThhhhheeeee llllleeeeefffffttttt ssssstttttiiiiillllllllll eeeeexxxxxiiiiissssstttttsssss,,,,, bbbbbuuuuuttttt ooooonnnnnlllllyyyyy aaaaasssss aaaaa vvvvveeeeehhhhhiiiiicccccllllleeeee fffffooooorrrrr rrrrreeeeegggggiiiiisssssttttteeeeerrrrriiiiinnnnnggggg the garden, which sprouts spontane- The Garden of the Peculiarities, ppppprrrrrooooottttteeeeesssssttttt..... IIIIItttttsssss ttttteeeeennnnneeeeetttttsssss (((((oooooppppppppppooooosssssiiiiitttttiiiiiooooonnnnn tttttooooo aaaaauuuuutttttooooonnnnnooooommmmmyyyyy,,,,, cccccooooonnnnntttttiiiiinnnnnuuuuueeeeeddddd mmmmmaaaaassssssssss ppppprrrrroooooddddduuuuuccccctttttiiiiiooooonnnnn,,,,, eeeeevvvvveeeeerrrrr----- ously and organically. recently published in nnnnneeeeewwwww ttttteeeeeccccchhhhhnnnnnooooolllllooooogggggyyyyy))))),,,,, fffffaaaaarrrrr fffffrrrrrooooommmmm eeeeennnnneeeeerrrrrgggggiiiiizzzzziiiiinnnnnggggg ttttthhhhheeeee ssssstttttrrrrruuuuuggggggggggllllleeeee,,,,, aaaaarrrrreeeee iiiiinnnnncccccrrrrreeeeeaaaaasssssiiiiinnnnnggggglllllyyyyy rrrrreeeeecccccooooogggggnnnnniiiiizzzzzeeeeeddddd aaaaasssss pppppaaaaarrrrrttttt ooooofffff ttttthhhhheeeee ppppprrrrrooooobbbbbllllleeeeemmmmm ————— mmmmmooooorrrrreeeee rrrrreeeeeaaaaasssssooooonnnnnsssss fffffooooorrrrr ttttthhhhheeeee eeeeennnnnvvvvveeeeelllllooooopppppiiiiinnnnnggggg cccccrrrrriiiiisssssiiiiisssss..... Efficiency expands Buenos Aires, Argentina. TTTTThhhhheeeee fffffiiiiiggggghhhhhttttt fffffooooorrrrr llllliiiiifffffeeeee,,,,, hhhhheeeeeaaaaalllllttttthhhhh,,,,, aaaaannnnnddddd fffffrrrrreeeeeeeeeedddddooooommmmm hhhhhaaaaasssss bbbbbeeeeeeeeeennnnn rrrrreeeeennnnneeeeewwwwweeeeeddddd,,,,, aaaaannnnnddddd gggggoooooeeeeesssss fffffooooorrrrrwwwwwaaaaarrrrrddddd and colonizes, The book is being translated nnnnnooooowwwww aaaaattttt aaaaa dddddeeeeepppppttttthhhhh ttttthhhhhaaaaattttt cccccaaaaannnnnnnnnnooooottttt bbbbbeeeee hhhhhiiiiinnnnndddddeeeeerrrrreeeeeddddd..... TTTTThhhhheeeee bbbbbrrrrreeeeeaaaaakkkkk wwwwwiiiiittttthhhhh ccccciiiiivvvvviiiiillllliiiiizzzzzaaaaatttttiiiiiooooonnnnn aaaaannnnnddddd iiiiitttttsssss bbbbbaaaaasssssiiiiiccccc ignoring all pecu- by Daniel Montero and is fffffooooorrrrrccccceeeee-----fffffiiiiieeeeelllllddddd ooooofffff cccccooooonnnnntttttrrrrrooooolllll aaaaannnnnddddd dddddeeeeessssstttttrrrrruuuuuccccctttttiiiiiooooonnnnn iiiiisssss uuuuunnnnndddddeeeeerrrrr wwwwwaaaaayyyyy..... AAAAAttttt bbbbbooooottttttttttooooommmmm,,,,, ttttthhhhhaaaaattttt iiiiisssss wwwwwhhhhhaaaaattttt iiiiittttt’’’’’sssss liarity. Because of edited by Janine and Jesus aaaaallllllllll aaaaabbbbbooooouuuuuttttt nnnnnooooowwwww..... this, its function is to Sepulveda. Front Cover: (Photograph) from Tiwi VVVVVVooooooiiiiiicccccceeeeeessssss ooooooffffff tttttthhhhhheeeeee FFFFFFiiiiiirrrrrrsssssstttttt DDDDDDaaaaaayyyyyy:::::: Corroboree Bathurst Island AAAAAAwwwwwwaaaaaakkkkkkeeeeeennnnnniiiiiinnnnnngggggg IIIIIInnnnnn tttttthhhhhheeeeee AAAAAAbbbbbboooooorrrrrriiiiiiggggggiiiiiinnnnnnaaaaaallllll DDDDDDrrrrrreeeeeeaaaaaammmmmmttttttiiiiiimmmmmmeeeeee TTTTThhhhheeeee SSSSSwwwwwooooorrrrrddddd,,,,, ttttthhhhheeeee PPPPPlllllooooouuuuuggggghhhhh,,,,, ooooorrrrr ttttthhhhheeeee DDDDDrrrrreeeeeaaaaammmmmiiiiinnnnnggggg bbyy RRoobbeerrtt LLaawwlloorr The lack of any form of agriculture in Aboriginal Australia is now fully recognized as a result of a conscious choice. It is not, as Darwinian experts previously claimed, due to SSSSSeeeeelllllfffff aaaaannnnnddddd EEEEEaaaaarrrrrttttthhhhh racial deficiencies, or the result of environmental hardship. Rather, it was an active choice Each Aborigine knows his country as he knows himself, through his own body and the of Aboriginal culture to adhere to their ancient Dreamtime Law. The Dreamtime stories internalized images of his dreaming places — these are his identity. There is no Aboriginal are the longest continuous religious belief documented anywhere in the world. In all the story that does not make reference to places, and land formations are never discussed thousands of stories, hunting and gathering is the only form of food procurement without reference to their mythological stories. mentioned. The adventurous joy of hunting and foraging, free and naked in the open air Due to the mystical interrelationship of these two most profound realms of existence of primal forests, makes other possibilities unthinkable for a healthy, sensual, and spiritual — the physical body and the extended body of the surrounding environment — the people. As anthropologist Leslie White suggests, “Hunting and gathering society was notion of possessing country or of land as a separate object has no place in Aboriginal unquestionably the most satisfying social environment (hu)man has ever lived in.” consciousness. There are no words denoting possession in Aboriginal languages. An Paleopathologists who study the skeletons of ancient hunter-gatherers say they tend Aborigine may speak of “holding” country, referring to obligations inherited for to be stronger and more robust and show fewer signs of degenerate diseases than maintaining certain sites, but he never speaks of ownership. Like the human body, the those of later agriculturalists. The very real necessities of agriculture — the tedious country is considered non-segmentable. There are distinguishable features such as thigh, repetition and endless chores of crop cultivation; the necessity of laboring on and abdomen, and chest, but they form integral parts of a continuous living being. An old defending denuded, exhausted plots of land from weather damage, insects, and wildlife; Aborigine said of the ever-present barbed wire fences in rural Australia, “White the bondage to one particular locality and one measured domicile — were responsible for man’s fences strangle the music of the countryside, just as clothes strangle the music the separation of human activity into the duality of work and play. In all hunting and of the body.” gathering societies there was no real differentiation between the two. As physiologist The present ecological effort to re-establish a bond between human societies and the Jared Diamond argues, “Agriculture is the worst mistake in the history of the human race.” natural environment seems superficial compared to the Aborigines’ deep identification with nature. For more than 100,000 years, this deep connection has prevented Aboriginal HHHHHeeeeerrrrrooooo/////DDDDDeeeeessssstttttrrrrroooooyyyyyeeeeerrrrr::::: TTTTThhhhheeeee TTTTTwwwwwooooo FFFFFaaaaaccccceeeeesssss ooooofffff PPPPPooooowwwwweeeeerrrrr culture from exploiting the earth’s environment; we must seek to understand this level of Historically, the most extreme cultural contrast has been that between hunting-gathering identification in transforming our relationship with the earth. Bioregionalism, the practice and agricultural, city-based societies. These two societies radically conflict on every level of relying on resources from one’s own region rather than world resources regardless of of existence from the spiritual to the physical. The confrontation of these two cultural relative need, is a philosophy that aims at developing people’s respect for the particular forms has often meant the genocide of the hunter-gatherers. Often, these acts of mass place where they live. If our irresponsible exploitation of the earth is replaced with a destruction are glorified as colonial heroism, as in the case of the decimation of the social order in which people again derive their sustenance directly from their surrounding Native American and Australian Aboriginal cultures. “The famous American historian, environment, human societies can transcend the obsessive concerns with the individual Francis Parkman, wrote of the American Indian: ‘He will not learn the arts of civilization, and again learn to treasure the earth. and he and his forest must perish together.’” “I feel it with my body, with my blood. Feeling all these trees, all this country... when the wind blows you can feel it. Same for country... you feel it. You can look, but feeling... that put you out there in the open space.” GGGGGGrrrrrreeeeeeeeeeeennnnnn AAAAAAnnnnnnaaaaaarrrrrrcccccchhhhhhyyyyyy ######111111111111 page 2 Male rule, womyn hating, racism, warfare, imperialism, materialism, anthropocentricity, specisism, aggression, competition, believing humanity to be separate and superior to the natural world, psychic and emotional encasement, invulnerability, hierarchialism, objectification, exploitation, n d techno-rationality, lack of intuition or insight and spiritual voidness — a s t these are some of the negative attributes which are consistent with a e u patriarchal culture. Taken as a whole, they form the cultural archetype q n C o now exhibited in the military industrial imperialism of our present times. P a t r i a r c h a l v i l i z a t i o n TdTohedtreoaruym,g himnoeuudct hhp oaowtfr ihwauremc hhaaanlvi ethy ,li isvmteodor,sy ,ta nmthdee nshe,o waan ttcdri ivbailluilz taeimtsi ophneasrv iheaa limvseto derceeov eonlroo mpleeisdcs,. C i scientific, political and military leaders are imbued with many of these a l life-smothering characteristics. The brutal landscapes and stagnant cesspools s t r i of modern industrial civilization are a real life mirror reflecting the d u extent to which the human spirit has been extinguished by the culture of n I patriarchal conquest. The ceaseless dark ages of history, now epitomized in the 20th century crises of extermination, starkly reveal that the longer human beings have adhered to, or been forced under domination of, the various strains of patriarchal thinking, the greater the anti-social centrality of such thought has permeated the character of human societies; and therefore, the greater by Brent Taylor by Brent Taylor the degree of violence, destruction and misery that all living beings and the environment of the Earth have experienced. On the path of patriarchal In Green Anarchy #10, we published an exclusive interview with which are negative and essentially anti-life. For example, the capacity of conquest things haven’t gotten better, they’ve gotten worse. All the multitudes Ann Hansen , a former member of the eco-anarchist armed struggle human beings to want to wage wars of total annihilation against their of negativity found throughout patriarchal history have compounded, cell, Direct Action, who engaged in a highly visible series of guerrilla enemies, or the quest to manipulate the natural environment to our mutated and expanded over time, eventually culminating in the toxic actions against patriarchal-industrial civilization in the early 1980’s anthropocentric ends, or to lust after material wealth with insatiable greed realities of modern times. in the occupied territory known as Canada. As a follow-up to that — these machinations which are so prevalent among the ruling classes With the advent of industrial civilization a qualitatively new era of interview, we’d like to reprint this essay by Brent Taylor, another of today — have also dominated the pursuits of previous eras and civili- destructiveness has come into being. Before industrialization, though member of Direct Action, who was sentenced in 1984 to a total of zations. Clearly, far back into history, well before the beginnings of the there was often unfathomable suffering and brutality, actual threats to 20 years in prison on conviction of conspiring to rob a Brinks Judeo-Christian era, the dominant conceptual outlook of civilization can the survival of all life on Earth did not exist. Therefore, irregardless of armored truck and a number of other weapons offenses. This essay— be described as being that of “patriarchal (male-dominated) conquest.” the many terrors people faced, in their dreams they could visualize an open-ended future full of possibility. Today this is no as timely and relevant as when it was written—will help to longer true: we live in dread of the horrors of clarify the politics of Direct Action for our readers who are industrial civilization, and daily we are confronted unfamiliar with the group or their struggle and will hopefully with the very real possibility of extinction. Industri- remind other green anarchists of the magnitude of what we’re alization has not only magnified the basic anti-life up against, and the increasingly dire need to start fighting dynamic of the patriarchal culture of conquest, it is back more effectively. This article also appears in the pamphlet, in fact a Frankenstein created by it. “The Writings of the Vancouver Five,” which can be The existence of industrial civilization cannot be ordered for $3.00 from the Green Anarchy Distro PO Box divorced from the historical process which eventually 11331, Eugene, OR 97440 enabled it to be created — that process being The apocalyptic horrors we face today — the looming patriarchal historical development. Industrial civili- nightmares of nuclear war or ecological catastrophe — are a zation stems totally from within the conceptual framework direct consequence of the industrial and technological civilization of the patriarchal mindset; and it is from that mentality created by materialistic capitalist and communist male power elites that the strivings to pursue it dwell. It would never over the past 200 years. These threats to our survival are entirely have come into being without human cultures having unique to this modern era, and would have been virtually first been mutilated by patriarchal conquest, and our inconceivable to people of former times. However, the true roots identification with the natural living world severed. If of industrial civilization — the consciousness and attitudes which I believe that within this mode of thought are ways of perceiving and we fail to make this connection, then we fail to understand the real eventually enabled such a civilization to come into being — first began being, sometimes subtle and sometimes brutally apparent, which must “nature” of industrial civilization. to fester in the societies of our ancestors long ago. Why we have only so be rejected if we are to survive and recreate lives and cultures of natural Industrial civilization is the definitive product of patriarchal conquest. recently come to be faced with the nightmarish reality of a crisis of freedom and harmony. Industrial development is not wrong simply because it is recklessly extermination is because the modern era is the first in which the actual At some point in our distant past, when early patriarchal societies utilized towards the ends of power and profit. Its very essence is wrong: potential for extermination exists. It was only through the actualization began to develop and then become established and powerful, a distancing all the premises upon which it was founded, and is maintained, are negative of an advanced industrial civilization that the machines, weapons and and disregard, and eventually contempt and conquest, over womyn, other and anti-life. It is inherent within the essential “nature” of industrial industrial processes were created which are now threatening the peoples and finally the natural environment came to be the principle civilization for it to be life-threatening. It is entirely consistent, therefore, survival of life on Earth. underlying premises upon which the ruling males governed. Since those that its existence has become such a grave threat to the survival of life. The present industrial and technological civilization is, in its global times, the magnitude of patriarchal conquest has steadily expanded, and To survive this crisis of extermination, it is simply not enough to isolate scale and its actual physical manifestations, vastly different from all other “human development” has been synonymous with the ever-increasing nuclear war, large-scale pollution or relentless profiteering as being the eras of so-called “civilized history.” From the stupefying rate of expansion institutionalization of patriarchal domination. The tragic effects of this offensive realities of industrial civilization, and therefore, as the only parts of the “industrial revolution,” and with the colossal productive capacity domination are not only evident today in the material conditions of of it that should be done away with. To do that would mean that we still of massive factories, the immense output from power projects, and the human societies, but as well, in the inner world of human beings. embraced, on the whole, most of the industrial “way of life” created in utilization of mega-scale resource extraction, etc., etc., ad nauseam, there Over thousands of years, the patriarchal culture of conquest has virtually the image of the patriarchal mentality. It would mean that we still is little question that the modern era, in a material sense, literally stands destroyed our inner grounding with what can be termed “a natural and adhered to the culture of patriarchal conquest. It is essential we come to beyond history. It has facilitated the most consumptive and materialistic holistic appreciation of life.” Such a severe spiritual crippling has left us realize that it has been, and will continue to be, our basic adherence to societies ever — which are surely a science fiction fantasy when compared collectively wounded and astray. This is particularly true in advanced the patriarchal mentality which is the real threat to life, and the funda- with even the most developed urban centers of the 18th century. Yet it is industrial societies where an extremely distorted and lifeless view of mental reason why the likelihood for doom is ever consuming us. Inevitably, not because of a new mode of thinking that human existence has been so living exists. Not only has much of the reverence and worship of life itself if we are to survive and create a better world without warfare and the rapidly transformed. vanished, but it appears that these societies have become incapable of possibilities of extinction, a complete abandonment of the culture of Industrial civilization has evolved from the cumulative effects of an recognizing the fact that they are creating an execution chamber world by patriarchal conquest must occur. Such an abandonment must certainly unbroken adherence to perceptions, concepts and philosophical values the very manner include “industrial civilization” in its entirely. in which they We must come to recognize the degree to which our understanding are functioning and perceptions of life and the external world have been determined by and by the very patriarchal conquest, and how we have developed our societies as a motives which result of this. Then we can clearly see how history has been charted, drive them civilizations built, and finally, how industrialization has come to dominate onward. and threaten our existence because of the lifeless images and vision of Patriarchal the patriarchal mentality. We will be far better able to make positive conquest has choices about what kind of societies we want to create, and about what become an all- we need to do to survive, if we realize the extent to which the “developments” embracing of history, and the technologies of today, are actually the manifested battle of con- realities of this entirely morbid process of thought. quest over all For us to really become clear about what we need to do in this struggle life for the ends for survival, we must rid our inner beings of the negative attributes of of greed and patriarchal thinking, but as well, we must rediscover our physical power for rulers connection and dependency upon the Earth, and re-unite ourselves and empires spiritually within nature. Only from a renewed appreciation and knowledge of —to bury variety, natural life processes can we once again come to possess a meaningful spontaneity and understanding of the proper ways to live. Through such an understanding vitality in a coffin we can gain the direction and strength necessary to wage the struggles of artificiality, that are needed, and the vision to fight against the deadly, artificial domination existence of industrial civilization; not to reform it, but to do away and control. with it completely. page 3 GGGGGGrrrrrreeeeeeeeeeeennnnnn AAAAAAnnnnnnaaaaaarrrrrrcccccchhhhhhyyyyyy ######111111111111 ..... BBBBBEEEEEYYYYYOOOOONNNNNDDDDD VVVVVEEEEEGGGGGAAAAANNNNNIIIIISSSSSMMMMM BBBBBEEEEEYYYYYOOOOONNNNNDDDDD TTTTTHHHHHEEEEE ..... CCCCCOOOOONNNNNSSSSSUUUUUMMMMMPPPPPTTTTTIIIIIOOOOONNNNN OOOOOFFFFF DDDDDOOOOOMMMMMEEEEESSSSSTTTTTIIIIICCCCCAAAAATTTTTIIIIIOOOOONNNNN “They’ll be feeding us, They’ll be feeding on us...” YYYYYOOOOOUUUUU AAAAARRRRREEEEE WWWWWHHHHHAAAAATTTTT “We will learn We will love We will work, Change each other....we will spread, we will cover the Earth, like air and water, YYYYYOOOOOUUUUU EEEEEAAAAATTTTT tomorrow’s blank, we’ll just fill it in, with our own answers, If we’re stopped we’ll just start again, that’s our new offer.” Slow down for a moment and put this paper aside. -Desaparecidos, from Read Music, Speak Spanish Reflect on your body, your limbs. Think for awhile “Eating establishes humankind’s most primordial bonds with the natural world. Because it utilizes the senses, eating, more than any about the processes that occur in your organs and their other human experience, brings us to our fullest and most intimate relationship with the environment. In recent generations this intimate cells as you tell your arm to move, as you tell your relationship has been shattered by a food production system that has profoundly separated us from nature and from those working the fingers to turn the pages of this zine. Now, consider land. Under the rubric of “progress” we have bought into being mere consumers, passive cogs in the alienated industrial food system. But what is taking place in your body when taking in cells now, more and more of us have realized that “progress” is an incomplete concept; we have begun to ask, “Progress toward what?” Once the and air from the environment. There is something that question is asked, the response is chilling. Industrial “progress” leads us to a future of increased environmental devastation, mass starva- tells these cells to create our physical form. There is tion, social disruption, and corporate control of the seeds of the Earth. Clearly, this is not progress.” -From Fatal Harvest some intelligence within our being that organizes cells into what are our organs, our limbs, our eyes, everything Life has become domestication. Almost the entire world VVVVVEEEEEGGGGGAAAAANNNNNIIIIISSSSSMMMMM::::: DDDDDOOOOOCCCCCTTTTTRRRRRIIIIINNNNNEEEEE it can eliminate, it begins to break down into two true we are in the material world. What is this intelligence populace is wrapped up into the forced prescription hallucinogens, adrenochrome and adrenalutin. These that makes us up out of a chaotic universe and holds OOOOORRRRR DDDDDOOOOOGGGGGMMMMMAAAAA????? of a psychotropic and physically addictive linear reality. chemicals distort and narrow consciousness, induce our cells together? We have to live in our bodies, so we Welcome to civilization. This, and ever more of This Veganism is a dogmatic and ignorant ideology that paranoia, and reinforce obsessive-compulsive behavior. might as well start thinking about how they work. is progress enshrined, cemented over the wild as into keeps us from communing with all life by creating a In short, they cause schizophrenia. Consistent with what There is a functioning intelligence that makes our being. Our very cells possess intelligence and false dichotomy between the mutilation of plants, insects, militant vegetarians have been saying for years, when atoms into molecules, molecules into organelles and memory. This idea has been arrived at by practitioners and wild areas and the similar mutilation of our animals raised in oppressive, prison-like conditions cells, cells into organs and flesh and all of this together of many different eastern spiritualities, western animal brothers and sisters. Noble it is to not consume are callously slaughtered by assembly line workers, equals our functioning human body. This intelligence sciences, quantum physics and hunter-gatherer bands. the flesh of beings who have been raised as slaves, but the fear and horror of their existence is released is equivalent to what motivates matter to congeal into A deliberate and ingenious plot to program life at the how noble to leave plants out of our conception of biochemically into their bodies, which we consume, plants, trees, animals, insects, mountains, oceans, rivers cellular level and beyond—read nano-tech—is being living beings? How noble is it to consume “organic” and which then become a part of our own lives. and everything else we see (some may say, “it is the played out by those in control of the machine- This is only one example of how brain that organizes our cells into our bodies!” To like existence we are conditioned to accept. civilization colonizes our minds, you I pose the question, what intelligence, then, tells It is a myth we are enculturated into and spirits and cellular structure by our cells to form our brains?) Some kind of energy mangled by constantly. The computer- conditioning our body chemistry holds everything together. Through the life and death generated reality outlined in the movie The itself. Just as civilization and its processes, which all involve the eating of one form by Matrix is much closer to the world that has totally repressive social order train another, all matter and energy in the universe constantly been devised for us than people are willing (program) us from birth to accept ebbs and flows in and out of every existing piece of to wake up to. By teaching, no, forcing us a fear-ridden, schizophrenic way of matter. Every breath of air we inhale has been shared to consume domestication—the torture, “life,” the domestication of our wild by every plant, animal and human that has ever existed. rape, imprisonment and assimilation of natures sinks in past the level of Air pollution tells the same tale, as we take in air, full plants, animals, insects, soil, habitat and verbal conditioning, to our body of hydrocarbon chains, smoke and tar from factories wildness in every form—the heads of state chemistry, regimenting our metabo- and cars, we realize the interconnectedness of all air and those wielding power are physically lism and nervous systems, trapping on the planet. In the same manner with which we share redesigning our minds and bodies. The us in set patterns of behavior and air with every living thing, we also share cells with every blueprint with which they work has built thought, taming us. To fully control creature and “inanimate” objects because we all eat within it ten thousand years of knowledge our minds and confine our aware- and get eaten by one another as we have since the of tyrannical manipulation procedures. ness the system needs to first create beginning of life as we know it. The processes of eating, Nazi scientists honed, and continue to hone, mental confusion in its subjects, drinking and breathing can all be done consciously or their knowledge of severe forms of social through both psychic and dietary unconsciously. Even though we must exert deliberate and individual control to the point of means. Consuming poisons will poison energy to eat or drink, we can choose to be much more extinguishing the possibility of thinking us, irradiated foods irradiate us, alert and aware of these many-times-daily events. The about freedom. Whoever sits at the throne and by consuming domestication immediate reasons we should start paying attention to of civilization knows full well what they are and linearity, we become domesti- our bodily functions are quite clear from this perspective: doing. Leftism, reformism, veganism, and cated and linear. as we become more aware of the universes dancing all other ideologies make up integral parts All change is due to the re- within our bodies, we can become ever closer to the way of their machine. They keep us dutifully arrangement or motion of energy the greater universe works and the powers waiting for hacking away at the edges of their castle, patterns relative to each other. The us within it. Like a tiny Zen garden compared to a large while we never realize that we are only vibration patterns we choose to one, the microcosm is the same as the macrocosm. polishing the walls of our cage. associate with—especially with Think about what must occur when you consume Their tools of control are deceptive and regard to domesticated or wild the cells of other once-living beings, plant or animal. require of us energy, attention and the food—can play an integral role in How does your body break down and process the cells knowledge of many years of conditioning the de-civilizing process. If we you eat? What happens to the intelligence built into the to even accept their existence. Cars, roads, recognized the true power of any- cells, DNA if you will, when it is consumed by another farm fields, grocery stores, rocket ships, air- thing we put into our bodies, then being? We literally become what we eat, drink and planes, cities, and concrete landscaping for we would choose foods with the type breathe. If we are constantly eating domestication in miles and miles and miles are all absurdities. of energy vibrations for the level of any form, drinking sold and processed water and None of these things were familiar or acceptable in any crops, still planted in linear rows, fertilized and consciousness (mental freedom) and physical adventure breathing smoke and toxin filled air, then it follows way to North American tribal people when the European nourished by the shit of enslaved creatures? This shit we would like to experience. We would choose foods that that we become domesticated, processed, sold and machine arrived on the shores. They saw through the contains antibiotics, and any other poisons injected detoxify and strengthen us, and as a result, help snap the filled with smoke and toxins. Anti-authoritarians would domestication for what it was. It’s high time anarchists into the shit’s producer by its proclaimed owner. ropes of civilized, well-ordered thoughts and habits and be wise to consume liberation, the animals and plants and anyone else concerned with liberation start Nourishment by these means still contains linear con- loosen the boundaries of accepted, manufactured “reality.” that live wild and free up until the moment of their questioning what exactly it is we are putting into our ditioning, from the ground up. Healthy diets may or At this point, diet becomes not an issue of morality or death, rather than the planned linear existence of bodies and onto the Earth. may not contain meat; this is not the question being “political correctness,” but a part of reclaiming our lives farmed plants and animals. Our cells must be We know the ways they mutilate our minds: posed. What to include in one’s diet is a personal, and minds through any available means and strategies. liberated if our beings are to be truly free. television, computers, science, western religions, bioregional decision which must always be respectful Wild foods alter our biochemical and molecular disease, medical technology. Let us now consider how toward all life and mineral that is to be consumed. makeup—as does the poison embalmed dead food EEEEENNNNNHHHHHAAAAANNNNNCCCCCIIIIINNNNNGGGGG WWWWWIIIIILLLLLDDDDDNNNNNEEEEESSSSSSSSSS they rape our bodies, our spirit and the living, The simplistic radical vegan assertion that “meat is that the system successfully sells us—and almost TTTTTHHHHHRRRRROOOOOUUUUUGGGGGHHHHH FFFFFOOOOOOOOOODDDDD breathing endangered wildness from which we have murder” is unarguable within a certain limited ideo- alchemically start to reconnect us to the feral path. not yet been fully estranged. Let us now build a love logical framework, but it really only begins to scratch Wild foods will aid us in the radical act of reuniting with AAAAACCCCCQQQQQUUUUUIIIIISSSSSIIIIITTTTTIIIIIOOOOONNNNN and gratitude towards all life: plant, animal, insect, the epidermis or outer layer of how the vibrational sources of power the system has tried to hide from us Extrapolating from the idea that all cells have a fungus, bacterium—rock, river, mountain, desert, essence of all we ingest, breathe, consume and surround and destroy, forces and “realities” that were and are memory and an intelligence, even the foodstuffs we forest, prairie and consume only what is necessary ourselves with affects and alters our own vibrational known by all primal peoples, by all of our ancestors. acquire that have their origins in slavery may still be of for existence. In loving ritual, let us experience the patterns, and hence, our mental and emotional states. Wild foods help us go wild and develop circular and value. Their value may be enhanced by the ways in wisdom of the ages that can bring us back to a deep Certain dietary theorists argue that schizophrenia complete relationships with Earth and her creatures, as which we acquire, process, handle and consume them. profound connection with wildness. Living beings of (which afflicts more people in the Western World than contrasted with the separated, linear control patterns If we are consciously grateful for the food we this planet are resisting the onslaught of civilization. cancer, diabetes and heart disease combined) is related that seem to typify western patriarchal thinking. consume, empathetic and aware of what oppression With the war already in progress, we must consume to a protein toxemia caused by ingesting excessive The ideas we’re discussing here actually have very it may have suffered, we can let that cellular intelli- and become wildness so that wildness may spread and amounts of tryptophane-laden beef, the chemical and little to do with veganism, and a lot more to do with gence know that we wish to make a different world for consume us and undo all the destruction our culture hormone marinated flesh of our dead bovine slaves. discovering who our plant and animal allies are, that all life and hence, be nourished more consciously and has done. Canadian psychologist Abram Hoffer observed that is to say, the sources of energy that will give us the directly through communication between our cells and when the human body produces more adrenaline than strength we will need to destroy this civilization. others. This can be approached from another angle. GGGGGGrrrrrreeeeeeeeeeeennnnnn AAAAAAnnnnnnaaaaaarrrrrrcccccchhhhhhyyyyyy ######111111111111 page 4 When sexual interactions occur between two or more of domestication and control by quitting civilization in and kindness exists under the surface of every bit of people, the more genuine and honest the communication every way possible. The way we approach life must concrete. Be inspired by what can be found beneath between the individuals, the more fulfilling and amazing change radically; inherent in this change will be the the iron masks welded to our faces. Civilized armor AAAAA HHHHHAAAAAIIIIIKKKKKUUUUU OOOOORRRRR TTTTTWWWWWOOOOO the connection. When two individuals cross the line liberating potential to shatter every illusion of control weighs down our lives. Our eyes have been filled so into a physical relationship, there are energetic and and domination enforced upon us. long by darkness that waking up is like walking out of PPPPPsssssyyyyyccccchhhhhiiiiiccccc mmmmmiiiiissssseeeeerrrrryyyyy cellular bonds and exchanges between those individuals. Is there anyone who would argue that microwave a theater into a mid-morning summer sun. The first DDDDDooooommmmmiiiiinnnnnaaaaattttteeeeesssss eeeeevvvvveeeeerrrrryyyyy lllllaaaaannnnndddddssssscccccaaaaapppppeeeee Cells and energy intermingle between our bodies and food is better than food prepared by the light of a glimpse of freedom is blinding and frightening. From HHHHHooooowwwww cccccaaaaannnnn wwwwweeeee rrrrreeeeesssssiiiiisssssttttt ????? the food we eat. The more loving and wild the food, campfire deep in the woods? Liberated food—that is, there, the butterflies never leave your stomach and the more loving and wild the person. We must learn to food that has been expropriated from its sterile place dreams never leave your consciousness. It’s a long wild DDDDDeeeeessssstttttrrrrroooooyyyyy aaaaallllllllll ttttthhhhheeeee cccccllllloooooccccckkkkksssss show the same gratitude for the food we eat and the on the shelves of urbania/suburbia—may experience ride from domestication to liberation. About as long of AAAAAnnnnnddddd yyyyyooooouuuuu wwwwwiiiiillllllllll sssssuuuuucccccccccceeeeeeeeeeddddd iiiiinnnnn ttttthhhhheeeee environments that sustain us as we wish to show our a rush of sorts that reinvigorates the cells in the food a ride as it is from where you’re sitting to the nearest DDDDDeeeeessssstttttrrrrruuuuuccccctttttiiiiiooooonnnnn ooooofffff tttttiiiiimmmmmeeeee lovers, families and friends. Patriarchy is evident in as it’s being rescued from the grips of capitalism. Maybe wildlands, or if you’re feeling particularly joyous, wildness our beings down to the way we consume our food. It plants and animals hate commerce and trade as much is always near. It burns brightest where there are riots, EEEEEnnnnnddddd ooooofffff OOOOOpppppppppprrrrreeeeessssssssssiiiiiooooonnnnn is said that the same philosophy which oppresses women as some of us humans. There are surely enough reports revolts, and actions against the state and power structures. AAAAArrrrrrrrrriiiiivvvvveeeeeddddd aaaaattttt vvvvveeeeerrrrryyyyy qqqqquuuuuiiiiiccccckkkkklllllyyyyy also oppresses the Earth. Anarchy must encompass a of animals and plants and climates revolting meaning- There are less obvious reasons why the underground WWWWWhhhhheeeeennnnn tttttiiiiimmmmmeeeee iiiiisssss eeeeerrrrraaaaassssseeeeeddddd constant empathetic awareness of how everything and fully against civilization to convince us that our allies is called underground; Peg Millet of Earth First!; everyone around us is being oppressed. in this war are many. We have just been taught to not claimed she became a cactus in the desert to avoid LLLLLaaaaannnnnggggguuuuuaaaaagggggeeeee eeeeennnnnaaaaabbbbbllllleeeeesssss Food, acquired through donation, handled by loving consider other life as intelligent as ourselves. It is time to capture by helicopters, FBI agents with dogs and other OOOOOpppppppppprrrrreeeeessssssssssiiiiiooooonnnnn ooooofffff ttttthhhhheeeee mmmmmaaaaasssssssssseeeeesssss and giving individuals and handed out to those in need, defy the absurd disconnection that civilization illusions pigs who had surrounded her and her comrades. Our IIIIIttttt kkkkknnnnnooooowwwwwsssss nnnnnooooottttt ooooofffff rrrrraaaaaccccceeeee contains much nourishing potential. Virtually all of the over us. Tear off your masks, tear off the headphones, wild brothers and sisters are full of gratitude for our WWWWWiiiiittttthhhhh eeeeennnnnddddd ooooofffff nnnnnuuuuummmmmbbbbbeeeeerrrrrsssss food in supermarkets is processed and domesticated. take a walk in the woods, remember that Cherokee actions to defend them and to cultivate wildness within AAAAAlllllsssssooooo eeeeennnnndddddsssss aaaaallllllllll mmmmmeeeeeaaaaasssssuuuuurrrrreeeeemmmmmeeeeennnnnttttt A growing amount of it is irradiated with nuclear con- warriors would stand in the forest with their backs to ourselves and without. Plants, animals, insects, and NNNNNooooo mmmmmooooorrrrreeeee ppppprrrrrooooopppppeeeeerrrrrtttttyyyyy taminants while our water contains a waste product of large trees to regenerate energy for travel and battle. all other forms of life are fighting to survive and re-grow aluminum production, commonly known as fluoride. There is power in this world that is autonomous and over the concrete wasteland our civilization has IIIIInnnnn rrrrreeeeefffffuuuuusssssaaaaalllll ooooofffff Yet, what cellular intelligence remains in this food and liberating. This power lies in the communion of beings wrought. Now we stand alongside them. Now we learn TTTTTeeeeeccccchhhhhnnnnnooooolllllooooogggggiiiiicccccaaaaalllll llllliiiiivvvvviiiiinnnnnggggg water? How much interaction can we have with these beyond our silly language and species barriers. Native to communicate in whatever ways possible with these OOOOOnnnnneeeee fffffiiiiinnnnndddddsssss cccccooooonnnnnttttteeeeennnnntttttmmmmmeeeeennnnnttttt tortured, imprisoned cells? When we write letters to peoples did not learn plant identification from books, newfound comrades. Their struggles are ours. Be prisoners, the arrival of kind words brings a smile to a nor from trial and error. They learned the knowledge healthy, eat well, live well and love well. The heat of our CCCCCiiiiitttttiiiiieeeeesssss wwwwwiiiiillllllllll bbbbbeeeee rrrrruuuuuiiiiinnnnnsssss prisoner’s face and warmth to their day. Although of medicine through direct communication with each bodies is akin to the heat of lava, magma from the outer EEEEEmmmmmppppptttttyyyyy bbbbbuuuuuttttt tttttooooo ccccceeeeellllleeeeebbbbbrrrrraaaaattttteeeee imprisoned, they still feel emotions, still yearn to be individual plant. This is not a mystical ability. Truly core of the earth, full of burning energy that originates EEEEEnnnnnddddd ooooofffff pppppaaaaarrrrraaaaadddddiiiiigggggmmmmm free. Could it be possible to communicate to the food mystical is the way civilization—through economics, with the beginning of the universe. Let us burn within, we eat that we are liberators, and that we mean to put time, TV, computer, language, media, agriculture— comrades. Now we spread the fires of revolt. OOOOOwwwwwnnnnneeeeerrrrrssssshhhhhiiiiippppp iiiiisssss dddddeeeeeaaaaaddddd the energy we gain from them to liberating use? In the controls us down to the fiber of our beings. We must Bon Appetite! EEEEEvvvvveeeeerrrrryyyyyttttthhhhhiiiiinnnnnggggg bbbbbeeeeelllllooooonnnnngggggsssss tttttooooo aaaaallllllllll way a prisoner smiles and jokes in letters, so may plant start seeing through the haze and smog to embrace NNNNNooooo lllllooooonnnnngggggeeeeerrrrr nnnnneeeeeeeeeeddddd vvvvvooooottttteeeeesssss and animal cells that have been through industrial hell the connections that already exist between us and our * These sections are part of a larger enjoy our love and kindness and may even show gratitude plant, animal, insect, fungal, and bacteriological brethren. group of essays on “domestication”. RRRRReeeeeppppprrrrreeeeessssseeeeennnnntttttaaaaatttttiiiiivvvvveeeee while becoming part of us. This may be a way to put an “Beyond the Consumption of Domes- DDDDDeeeeemmmmmooooocccccrrrrraaaaacccccyyyyy dddddoooooeeeeesssss nnnnnooooottttt wwwwwooooorrrrrkkkkk end to the cycle of domestication. We may convert BBBBBooooonnnnn AAAAAppppppppppeeeeetttttiiiiittttteeeee!!!!! tication, Beyond the Programming of EEEEExxxxxccccceeeeepppppttttt tttttooooo ooooopppppppppprrrrreeeeessssssssss domesticated cells into wildness through our eating In life, as in death, proceed with dignity. Be attentive, Life”, and “Beyond the Programming LLLLLiiiiifffffeeeee cccccooooommmmmeeeeesssss tttttooooo aaaaannnnn eeeeennnnnddddd rituals. A father quits drinking alcohol to raise a new child, locate and spread beauty wherever it may be, taking of Life, Beyond Civilization” are other EEEEEcccccooooolllllooooogggggiiiiicccccaaaaalllll cccccooooollllllllllaaaaapppppssssseeeee breaking a multi-generational pattern of alcoholism risks and neither seeking out nor avoiding death. We sections which we may feature in the EEEEEnnnnnddddd ooooofffff bbbbbiiiiiooooosssssppppphhhhheeeeerrrrreeeee in his family. We can break the ten-thousand year cycle have nothing but illusions to get rid of. A world of joy future. Tell us what you think. AAAAArrrrrttttt iiiiisssss rrrrreeeeeiiiiifffffiiiiieeeeeddddd AAAAAbbbbbssssstttttrrrrraaaaacccccttttt ssssseeeeeeeeeennnnn aaaaasssss tttttaaaaannnnngggggiiiiibbbbbllllleeeee CCCCCuuuuullllltttttuuuuurrrrreeeee iiiiisssss aaaaa llllliiiiieeeee DDDDDiiiiiggggg IIIIInnnnn!!!!! 111110000000000,,,,,000000000000000 YYYYYeeeeeaaaaarrrrrsssss ooooofffff hhhhhuuuuummmmmaaaaannnnn eeeeexxxxxiiiiisssssttttteeeeennnnnccccceeeee PPPPPrrrrreeeee-----aaaaagggggrrrrriiiiicccccuuuuullllltttttuuuuurrrrreeeee 22222000000000000000 yyyyyeeeeeaaaaarrrrrsssss ooooofffff PPPPPooooossssstttttmmmmmooooodddddeeeeerrrrrnnnnn hhhhhuuuuummmmmaaaaannnnniiiiitttttyyyyy HHHHHaaaaasssss dddddeeeeessssstttttrrrrroooooyyyyyeeeeeddddd ttttthhhhheeeee EEEEEaaaaarrrrrttttthhhhh IIIII hhhhheeeeelllllpppppeeeeeddddd ssssstttttaaaaarrrrrttttt ttttthhhhheeeee fffffiiiiiggggghhhhhttttt SSSSStttttoooooppppp 5555555555,,,,, gggggooooo oooooaaaaakkkkk tttttrrrrreeeeeeeeeesssss TTTTThhhhheeeee tttttrrrrreeeeeeeeeesssss aaaaarrrrreeeee nnnnnooooowwwww cccccuuuuuttttt IIIIIfffff tttttrrrrreeeeeeeeeesssss wwwwwooooouuuuulllllddddd jjjjjuuuuusssssttttt ssssscccccrrrrreeeeeaaaaammmmm PPPPPeeeeeooooopppppllllleeeee mmmmmaaaaayyyyy uuuuunnnnndddddeeeeerrrrrssssstttttaaaaannnnnddddd ttttthhhhhaaaaattttt TTTTThhhhhiiiiisssss iiiiisssss hhhhhooooolllllooooocccccaaaaauuuuusssssttttt TTTTTooooonnnnnaaaaallllliiiiitttttyyyyy iiiiisssss HHHHHaaaaarrrrrmmmmmooooonnnnniiiiiccccc dddddooooommmmmiiiiinnnnnaaaaatttttiiiiiooooonnnnn AAAAAtttttooooonnnnnaaaaalllll rrrrreeeeevvvvvooooolllllttttt SSSSSccccchhhhhoooooeeeeennnnnbbbbbeeeeerrrrrggggg tttttrrrrriiiiieeeeeddddd tttttooooo TTTTTTTTTThhhhhhhhhheeeeeeeeee FFFFFFFFFFeeeeeeeeeerrrrrrrrrraaaaaaaaaallllllllll FFFFFFFFFFoooooooooorrrrrrrrrraaaaaaaaaaggggggggggeeeeeeeeeerrrrrrrrrr:::::::::: Much has been theorized about the social problems that have arisen due to EEEEEnnnnnddddd ttttthhhhheeeee tttttooooonnnnnaaaaalllll dddddooooommmmmiiiiinnnnnaaaaannnnnccccceeeee the abundance of food stores used by early agrarian cultures. The excess AAAAAnnnnnddddd sssssooooo dddddiiiiiddddd JJJJJooooohhhhhnnnnn CCCCCaaaaagggggeeeee fat stored by early agrarian females eating grain-based diets in sedentary communities is seen as a primary cause of overpopulation due to hyper- AAAAA ggggguuuuuiiiiidddddeeeee tttttooooo llllliiiiivvvvviiiiinnnnnggggg oooooffffffffff nnnnnaaaaatttttuuuuurrrrreeeee’’’’’sssss bbbbbooooouuuuunnnnntttttyyyyy TTTTT..... JJJJJ..... KKKKKaaaaaccccczzzzzyyyyynnnnnssssskkkkkiiiii fertility. The active lifestyle of hunter-gatherers is commonly seen as the LLLLLiiiiivvvvveeeeeddddd iiiiinnnnn ttttthhhhheeeee fffffooooorrrrreeeeesssssttttt fffffooooorrrrr yyyyyeeeeeaaaaarrrrrsssss iiiiinnnnn uuuuurrrrrbbbbbaaaaannnnn,,,,, rrrrruuuuurrrrraaaaalllll aaaaannnnnddddd wwwwwiiiiillllldddddeeeeerrrrrnnnnneeeeessssssssss aaaaarrrrreeeeeaaaaasssss..... key to physical fitness. Still, cultivated foods can have a healthful place in humyn diets, and hopefully learning from the mistakes of past humyn AAAAAlllllwwwwwaaaaayyyyysssss ssssseeeeennnnndddddiiiiinnnnnggggg bbbbbooooommmmmbbbbbsssss TTTTTHHHHHEEEEE WWWWWIIIIILLLLLDDDDD FFFFFEEEEEAAAAASSSSSTTTTT societies will help us find our way into an egalitarian future. Wild foods were the basis of the humyn diet for nearly a million years, depending on how you define “human.” Today only a small percentage SSSSSCCCCCAAAAAVVVVVEEEEENNNNNGGGGGEEEEERRRRR/////FFFFFOOOOORRRRRAAAAAGGGGGEEEEERRRRR of the world’s population survives entirely off of wild foods, with a This pamphlet was not created with the intention of encouraging hunting, larger percentage combining them with domestic crops. Studies by or giving up food cultivation altogether. Rather than returning to a purely anthropologists on primitive diets have confirmed what may seem “hunter-gatherer” lifestyle, we advocate a form of subsistence that combines instinctually true to many of us: that the leanness and purity of wild urban and rural horticulture/permaculture with what we call a “scavenger- meat sources, and the superior nutrient content of wild plants, helped forager” lifestyle. Although some die-hards may want to leave civilization the humyn species maintain excellent health and longevity for 99% of behind, set out for the wilderness and practice primitive hunting and humyn evolution. It is only in the last 10,000 years that domesticated gathering techniques (which we have much interest in practicing in the animals and plants have (for reasons unknown) entered the picture of case of survival), we are more interested in bringing wild food gathering humyn cultures. In our minds, this is not an absolute statement against and roadkill scavenging into our present day lifestyle. Our future vision is domesticated plants and animals, but it IS a clue as to the secrets of one of a horticultural, village-scale, community located near a wild area humyn health in prehistory. For example, primitive diets that have been for foraging, but as we are still landless, our current dietary habits combine studied in contemporary times have proved higher in calcium than our backyard-scale gardening, dumpster-diving, and bulk organic staples, along modern diets, without the use of any dairy products whatsoever. The with foraged plant foods and scavenged roadkill. abundance of leafy greens in primitive diets supply more than enough To get a copy of “Feral Forager: a guide to living off nature’s bounty calcium and countless other minerals and vitamins, and because of the in urban, rural and wilderness areas,” a great new zine including how lack of refining processes and “anti-nutrients” like sugar, caffeine, and carbonation, those vitamins are actually absorbed into the body, unlike to use roadkill, edible insects, wildcrafting plants for food and in the modern western diet. Similarly, native cultures of the far north, medicine, mushroom gathering, recipes, and much more! where animal proteins make up the majority of the diet, have shown Send $3 to Feral Forager, PO BOX 1485, Asheville, NC 28802 no incidence of the clogged arteries and heart diseases so commonly associated with animal fats in the modern world. or email: [email protected] page 5 GGGGGGrrrrrreeeeeeeeeeeennnnnn AAAAAAnnnnnnaaaaaarrrrrrcccccchhhhhhyyyyyy ######111111111111 The Teardrop Becomes a Dagger! Anarchist Resistance From Around the World Anarchy is simultaneously the independent media outlets as vehicles circulated around Athens that day, complete deconstruction and for inciting action as opposed to simply containing the slogan “Whoever does describing or reporting. We live in a world not learn from history is condemned to erasure of all forms of domination where the public mind is being colonized repeat it.” Spray-painted slogans such and the creation of new and by corporate phantasms—wraithlike as “The State is the only terrorist” and authentic ways of communicating images of power and consumption that “Support to all who don’t bow their and living that will banish haunt our dreams. This forces anarchists heads” were written all over Athens. At oppression from the earth forever. to ask the question: how do we box the end of the rally, near the entrance Why stop at anything short of with shadows? In other words, what of the Polytechnic School, organizers shape does an engaged politics assume paid tribute to police-assassinated these goals? From the colonized in an Empire of signs and corporate anarchists including Ch. Tsoutsouvis, M. ruins, anarchists rise from the lies? To launch an effective Info-war Kaltezas, Ch. Marinos, & others. Conser- wreckage, rubble in hand to against the Media Monopoly, we first vative Deputy Dora Bakoyianni, a leading break through every glassy illusion. and foremost need weapons, and one candidate for mayor of Athens, condemned They inspire many to open the way of acquiring them might be to lure the march: She is the widow of Paulos curtains and let in some sky. Let a corporate newscrew to a remote Bakoyiannis, another conservative location and strip them of everything, deputy who was assassinated by us meet under the stars and as our Greek comrades did recently in N17 in 1989. “It stirs up my rage and become the twilight just after the streets of Athens. repugnance,” Bakoyianni said. “I must sunset and just before sunrise. As the say that it is inconceivable for the birth- empire sets, our dreams will rise. SEPTEMBER 16, POLAND: place of civilization to present such an Anarchists Successfully image...with the desecration of innocent Defend Woman From victims and monuments in the city.” AUGUST 29, MINNESOTA: Teenage Anarchists Eviction OCTOBER 2, GREECE: Arrested For Setting Wroclaw—Approximately a dozen anarchists Apoyevmatini Newspaper Sheriffs Vehicle On Fire and squatters blocked the path of police Attacked! and bailiffs seeking to evict Ms. Barbara Hastings—Three anarchists, aged 17, Markiewicz, a pensioner who could not Athens—Following on the heels of nu- allegedly set fire to a Dakota County Sheriffs afford to pay rent. The police tried to merous anarchist solidarity actions with Department car, destroying it. Unfortu- claim that the eviction came as a result the November 17 (N17) urban guerrilla style capitalism, the brand-name chanted for his liberation. The anti- nately, the young men were arrested a of the complaints of neighbors, but the movement, about 30 masked youth purveyors of American “food,” fashion authoritarians & anarchists, numbering few days later and face felony charges. neighbors were united against the threw firebombs (three Molotov cocktails, and entertainment have never had it so at around approximately 300-350, according to some news reports) into good. Hardly a city on the planet is without marched as a “Committee Against State police. The bailiffs decided not to go SEPTEMBER 13, GREECE: through with the eviction. the entrance of the building housing the McDonald’s (and CNN, Pepsi, Levi’s and Terrorism.” When the protesters passed Anarchists Assault Cor- right-wing “Apoyevmatini” newspaper MTV). And no company more powerfully the US embassy, some anarchists porate Media Reporters OCTOBER 1, GREECE: oennt Fraenidceo ua nSdtr eae cta irn p acerknetrda ol Auttshiednes w. Tehree ccuolntuvreayl sa rtmhye thimana gMec Doof naa ldco’sn, qwuheicrhin igs sAmftaesrwheadrd lsu,x umrya ncya ras naanrcdh iosntse tbharenkw. Rally Against State & Athens—A group of anarchists assaulted damaged. “Apoyevmatini” publisher probably why they’ve been a target of stones against riot police. The cops camera crews and reporters outside the Media Terrorism Nikos Momferatos was shot dead in anarchists and others opposed to responded with tear gas. Some of the offices of a lawyer representing alleged Athens—In response to the terror 1985 by N17: a statement left at the homogenization, “sameness” and boredom gasses were thrown near cops without members of the urban guerrilla movement hysteria cultivated by the Greek main- scene by N17 claimed that Momferatos, for several decades. And humans aren’t protection equipment and they burst into November 17. More than a dozen assailants stream media after the arrests of “N17” a cabinet member during the military the only species that has grievances with tears, while some of the pigs vomited. took part in the attack, which caused revolutionary group members, a rally dictatorship, was a CIA employee/spy. McDonald’s, as evidenced by a recent In Thessaloniki, 3,500 people partici- property damage but no serious injuries. comprised of some 2,500 protesters “We shall uncover and strike down incident in the American capital. On pated in an anti-war rally. The anarchist The police made no arrests. The anarchist (anarchists, anti-authoritarians, and agents of the CIA in the press,” it said. October 30—the night before Hallow- block was made up of approximately 300 attackers smashed television cameras, radical leftists alike) took place, This recent action by anarchists was een—two deer jumped through the people. Some of them made solidarity stole media equipment and damaged organized by the Committee Against carried out to protest the media’s role window of a Washington, DC McDonald’s, graffiti on bank entrances, while others broadcast vans outside the law offices State Terrorism. The Greek mass media in the N17 coverage. Police rounded up bursting in on startled staff and employ- assaulted a corporate media journalist. of Gianna Kourtovik, who is representing has tried to present some old school 40 people for questioning in connection ees and causing minor injuries to four In Heraklion, the capital of Crete Island, the man accused of being the main anarchists as members of urban guerrilla with this attack, as well as with the customers. When animal control officers 300 people demonstrated against the war. executioner for spray-painting of pro-N17 slogans on walls arrived, one deer was trapped in the The anarchist block was the biggest and the underground during an Athens march by anarchists restaurant, while the other had jumped the anarchists made extensive graffiti N17 organization and leftists the previous day. If this type back through the window and was found during the rally. The attempt of cops to and his female of fierce, daily resistance was happen- in an adjacent field. make arrests failed as the anarchists companion. US ing in the Middle East, we would have pushed them away. In the general climate anarchists should seen it on the front page of every major OCTOBER 20, GREECE: of decay and corruption that permeates consider taking a US newspaper; as it’s just happening in Anarchists Vandalize Greek politics today, the Greek anarchists cue from the Greek Greece and can’t be blamed on Islam, University! are launching a heated campaign against strategy book. the American propaganda machine has the electoral parliamentary illusion, so The corporate been doing its best to censor the Greek Thessaloniki—A large group of anarchists the coming months promise to be sizzling! media are not our anarchist movement into oblivion. occupied and vandalized part of the friends, and Thessaloniki University campus, calling DECEMBER 9, ITALY: nothing is to OCTOBER 16, MEXICO: for the release of a detained November New Revolutionary Group Anarchist Vegetarian 17 “terrorist” suspect. Some 200 anarchist be gained from youth broke into the Physics and Bombs Police Station In working with Group Attacks McDonald’s Mathematics Department building and Retaliation For The them. There is Mexico City—A group of about 80 stayed there until the morning demanding enough local and Murder Of Carlo Giuliani people identifying themselves as the release of Yiannis Serifis, a 64-year-old independent ABOVE: Flyer members of the “Collective Front of trade unionist arrested the previous Genoa—On December 10, a previously media for us to from a Greek Anarchist Vegetarians” were arrested Sunday. Serifis was the latest in a string unknown group claimed responsibility completely scorn after a march through downtown Mexico of 18 N17 suspects to be charged since for bombings at a Genoa police station the corporate rally against City, where they protested outside the group began to unravel at the end the day before, saying that they were multinational state violence restaurants and spray-painted slogans of June. Greece’s asylum laws ban police a response to the death of a protester outlets which will distort our words and oppression. on a McDonald’s outlet. The group from entering any college campus unless during the anti-globalization protests in handed out anti-meat leaflets and expressly invited to do so by the univer- Genoa in 2001. The group, calling itself and ideas or bury blocked traffic briefly before they were sity authorities. Exploiting this law, the “July 20th,” sent several letters to police them beneath an RIGHT: Flyer from arrested. Earlier this year, community anarchists were able to cause $30,000 and local newspapers detailing the avalanche of activists in Oaxaca City led a series of worth of damage to the university. contents of the explosives used in the nationalistic pro- Greece depicting protests against the planned opening blasts. Italian news agencies quoted paganda. Consid- TV reporters as of a McDonald’s restaurant in the OCTOBER 31, GREECE: Genoa’s police chief, Oscar Fioriolli, as ering the size of City’s 450-year-old colonial main square. Anti-War Activists Stage saying the claim appeared credible. The the anarchist police scum. “movement” here There could hardly be a better symbol Protests Across The Coun- blasts shattered windows but hurt no for US cultural imperialism and standard- one. The group’s name refers to the day in the states vs. ization than McDonald’s, who shower try; Anarchists Express last year when anarchist Carlo Giuliani the size of the industrial juggernaut and groups and anyone speaking up in every new market in a hail of “sugar-coated Solidarity With Y. Serifis was killed during riots at the Group of its brainwashed masses, it might be in defense of the N17 group are portrayed bullets” and assist in the creation of a Eight summit in Genoa. The letter said our best interest to start reversing the as potential terrorists. Taking part in the On this day, many anti-war demos new world order that leaves every place the bombings were a reaction to equations of power with regard to the rally were many old school anarchists took place in many Greek cities. In Athens, on the globe looking like a California Giuliani’s death and “the torture and conventional channels of communication. that were arrested during the 80’s and 10,000 citizens demonstrated against strip mall; in the “developing” world, systematic violence perpetuated in the Grassroots Info-war refers to a war of subsequently released, the partner of the war. The rally had participation from cultural imperialism has long been seen as streets and police barracks in a vain words, an intensified propaganda war Giotopolous (alleged leader of N17 syndicalist groups, student unions, the handmaiden of political domination, attempt to repress the people’s that is a necessary first step in the according to pigs), & an anarchist block pro-peace groups, leftists and anarchists. another way for militarily and economi- response against the G-8 summit.” The transformation from word to deed. As comprised of some 800 comrades. The During part of the demonstration, anarchists cally strong empires to take advantage letter also threatened the pig who revolutionary anarchists we desire more anarchist block demonstrated the most and some radical leftists held banners of “weaker” victims. With the aggressive allegedly shot Giuliani. It said Mario than just a mere sharing of information vociferous protest by verbally assaulting calling for solidarity with imprisoned spread of globalization, the opening of Placanica should leave the country so his and dialogue; we want to help push cops, media journalists, and deputies. anarchist Y. Serifis (see our state repres- China and other previously off-limits relatives don’t have to “recognize his words towards action, to use our own Flyers with Hitler and Bush’s face were sion news section for more info) and markets, and the triumph of American- remains in a morgue.” GGGGGGrrrrrreeeeeeeeeeeennnnnn AAAAAAnnnnnnaaaaaarrrrrrcccccchhhhhhyyyyyy ######111111111111 page 6 GREECE: their masters desire. Yugoslavia and NNoott MMyy VViissiioonn The Base Of Death Afghanistan are but two recent examples. Military aircraft also carry Must Be Destroyed! out constant surveillance on the local The following statement was released population they claim to protect by a Cyprus anarchist group: The British against the invading army in the north. army have gone ahead with force to Now these murderers are declaring that begin work to install yet another giant the new antenna will not be a health ooff LLiibbeerraattiioonn antenna in the land they occupy outside hazard, using the ‘proof’ of ‘scientific Akrotiri village, regardless of the fact tests’. Science and the new information that this is against the will and the technologies are the new religions of health of the people of Akrotiri. death, and we must not listen to them, Commencement of the dirty work but in the first place to our hearts and began under protection of the army in desires. We must think and act according full riot gear after the SBA had violently to our own convictions. We must pppppaaaaarrrrrttttt ooooonnnnneeeee disposed of the few protesters who destroy what is oppressing us and others tried to stop bulldozers from entering. against who we have no grudge, bbbbbyyyyy LLLLLeeeeeaaaaafffff SSSSS..... AAAAAlllllooooonnnnneeeee This is a stark reminder that there is not recognizing who our real enemies are one but two, or rather three, occupying and fighting them with all the means armies in Cyprus: the Turkish, the British at our disposal. This struggle should not sanctioned, force. I reject both as different faces of and the Cypriot (which like all armies be delegated to the political parties, SSoommee TThhoouugghhttss oonn the same monster. These terms are irrelevant to will not hesitate to turn on its own even those who are against the base. anarchists, as we should fight against both. Even dwelling people to protect class interests). The The means they use, even if their brave OOrrggaanniizzaattiioonn,, too much in “anarchist” politics has its limitations. village people, under the threat to their militants put themselves on the line Sure, I like to discuss my feelings about organization means of subsistence, had decided to and get beaten by the police, always or lifestylism among other anarchists and radicals, FFeeddeerraattiioonnss,, aanndd go to work that day as normal, not end up at the negotiating table over but to most people, this is irrelevant. It has nothing to realizing perhaps the full implications the heads of those who elected them. do with their everyday lives. There are deeper PPllaattffoorrmmiissmm of what is happening around them. In Only self organization, direct action and connections to be made. I find that the most fulfilling the first place, living with the daily sabotage by all those who are really conversations I have with people are those about how presence of an active armed force interested in changing their lives will I am for autonomy. I understand anarchy to be synonymous much they hate their job, the alienation we all feel from each which is deployed in many parts of the find the way to uproot the pylons of with autonomy; to live and act upon one’s own beliefs and desires other and ourselves, the toxic world we all live in, the new island. This force, as well as destroying death. In this social struggle, which without outside or overriding influences of power; to be self- diseases and drugs that appear everyday, the destruction of a large part of the beauty of this island refuses the logic of militarism, patriotism sustaining; to live within one’s own, or a group’s own, limitations. the world around us, the fact that we cannot feed or take by causing ecological damage, and or parliamentarianism, the people will As a green anarchist, this idea of autonomy naturally flows into care of ourselves, that we have lost almost all control over killing local people with their toxins, is always find anarchists at their side. a force at war, sending bombers to kill Solidarity with the people of Akrotiri! my understanding of the concept of bioregionalism; to live within our lives, and the spiritual emptiness we all feel. These defenseless men women and children The base of death must be destroyed! the limitations of our immediate surroundings; to obtain all discussions only re-enforce my understanding that the human to whichever part of the world they and —Cyprus anarchist group. nourishment and satisfaction from our local area; to be most deeply condition has become a miserable one, and we are all connected to the specific geography, micro-climate, patterns, entrenched in it, that there are no political solutions to it, WWWWWeeeee wwwwwaaaaannnnnttttt tttttooooo ccccceeeeellllleeeeebbbbbrrrrraaaaattttteeeee ttttthhhhheeeee sssssoooooccccciiiiiaaaaalllll ddddduuuuussssskkkkk iiiiinnnnn ttttthhhhhiiiiisssss tttttwwwwwiiiiillllliiiiiggggghhhhhttttt plants, and animals (including humans) of the region in which we that our only hope is to figure out how to connect to a ooooofffff bbbbbooooouuuuurrrrrgggggeeeeeoooooiiiiisssss sssssoooooccccciiiiieeeeetttttyyyyy sssssooooo ttttthhhhhaaaaattttt ttttthhhhheeeee fffffiiiiinnnnnaaaaalllll bbbbblllllaaaaaccccckkkkk nnnnniiiiiggggghhhhhttttt live. To me, these terms —autonomy and bioregionalism— can different way of thinking and living. This is my “outreach”. I iiiiisssss mmmmmaaaaadddddeeeee vvvvveeeeerrrrrmmmmmiiiiilllllllllliiiiiooooonnnnn wwwwwiiiiittttthhhhh bbbbblllllooooooooooddddd..... - Renzo Novatore almost be used interchangeably. For me, they are the basis of my have no time for the patronizing crap of the liberals, and I anarchist experience. It is for this reason that I become suspicious have no tolerance for the authoritarianism and vanguardism when I hear anarchists speak of organization. What are they of the Left (including anarcho-leftism). I have no plans for organizing? Who are they organizing? Why are they organizing? the “masses”. I hope people have their own plans, and maybe I am fighting for a world that doesn’t need organizing, that doesn’t some of us will work together on a few. Maybe we can help need running, that doesn’t need controlling. Sure, it is helpful to to empower each other to take responsibility for our own think about how we resist and live together, to be strategic, and to lives, but it won’t happen by creating the perfect organization develop relationships with people outside our families, bands, cells, or infrastructure. affinity groups, scenes (or however else we group ourselves based History, personal experience, and their basic arrangement on deeper levels of trust, commitment, common goals, and desires), have shown me that the Federationist and Party models of but these relationships need to be organic in nature, not forced relating to one another are not liberatory, but instead are and superficial. Any meaningful and honest decisions can only be usually based on manipulation, coercion, and deception. They made in small groups consisting of those who are directly effected often contain representational structures, and despite good by these decisions. For resistance to be liberatory (which I believe intentions, are often hierarchical. Some go as far as to give is why we resist, and not because of guilt or concepts like justice), certain individuals militaristic and commanding titles as we must be directly connected to what we are fighting for. Yes, it “General Secretariat” and “Minister of...”. Ten Point Programs is important to learn about and support other struggles, but not as and Platforms tend to be the least common denominator of WWWWWWWWWWWWWWWhhhhhhhhhhhhhhhaaaaaaaaaaaaaaattttttttttttttt IIIIIIIIIIIIIIIsssssssssssssss CCCCCCCCCCCCCCCiiiiiiiiiiiiiiivvvvvvvvvvvvvvviiiiiiiiiiiiiiillllllllllllllliiiiiiiiiiiiiiizzzzzzzzzzzzzzzaaaaaaaaaaaaaaatttttttttttttttiiiiiiiiiiiiiiiooooooooooooooonnnnnnnnnnnnnnn??????????????? a substitute for our own. The basis for our resistance must come our hopes and dreams, and to me seem to disturbingly reflect out of our own struggle for liberation, and our support for others the neo-liberal nightmare I fight against. It seems that some can grow from that. anarchists’ need to “federate” stems from a need to feel Yes, we can, and need to, work with other individuals and groups part of something larger, to appear larger to others, to validate IIIIIIIIII ccccccccccaaaaaaaaaannnnnnnnnnnnnnnnnnnnooooooooootttttttttt ddddddddddeeeeeeeeeeffffffffffiiiiiiiiiinnnnnnnnnneeeeeeeeee iiiiiiiiiitttttttttt outside our own, but doing so in ways which do not sacrifice our their perspectives or beliefs, or just the typical leftist ideal of bbbbbbbbbbuuuuuuuuuutttttttttt IIIIIIIIII kkkkkkkkkknnnnnnnnnnoooooooooowwwwwwwwww hhhhhhhhhhoooooooooowwwwwwwwww iiiiiiiiiitttttttttt ffffffffffeeeeeeeeeeeeeeeeeeeellllllllllssssssssss autonomy and desires, and not compromising the autonomy and controlling resistance and having their replacement infra- iiiiiiiiiitttttttttt ffffffffffeeeeeeeeeeeeeeeeeeeellllllllllssssssssss lllllllllliiiiiiiiiikkkkkkkkkkeeeeeeeeee ccccccccccoooooooooonnnnnnnnnnccccccccccrrrrrrrrrreeeeeeeeeetttttttttteeeeeeeeee oooooooooonnnnnnnnnn tttttttttthhhhhhhhhheeeeeeeeee ggggggggggrrrrrrrrrroooooooooouuuuuuuuuunnnnnnnnnndddddddddd,,,,,,,,,, desires of others. We can work on specific or more general projects, structure already set up. Whatever the motivation, I think it we can unite for common goals or events, but again, these connections is important to look at these methods of relating to each aaaaaaaaaannnnnnnnnndddddddddd wwwwwwwwwwaaaaaaaaaallllllllllllllllllllssssssssss aaaaaaaaaallllllllllllllllllll aaaaaaaaaarrrrrrrrrroooooooooouuuuuuuuuunnnnnnnnnndddddddddd need to be organic, based on real interactions and honesty, and other and ideas of organization with a critical and wary eye iiiiiiiiiitttttttttt ffffffffffeeeeeeeeeeeeeeeeeeeellllllllllssssssssss lllllllllliiiiiiiiiikkkkkkkkkkeeeeeeeeee eeeeeeeeeexxxxxxxxxxhhhhhhhhhhaaaaaaaaaauuuuuuuuuusssssssssstttttttttt bbbbbbbbbbuuuuuuuuuurrrrrrrrrrnnnnnnnnnniiiiiiiiiinnnnnnnnnngggggggggg iiiiiiiiiinnnnnnnnnn yyyyyyyyyyoooooooooouuuuuuuuuurrrrrrrrrr lllllllllluuuuuuuuuunnnnnnnnnnggggggggggssssssssss,,,,,,,,,, seen as temporary junctures of interest. Once these relationships (and this does not even begin to detail the endless list of aaaaaaaaaa lllllllllleeeeeeeeeessssssssssssssssssss oooooooooobbbbbbbbbbvvvvvvvvvviiiiiiiiiioooooooooouuuuuuuuuussssssssss ffffffffffoooooooooorrrrrrrrrrmmmmmmmmmm ooooooooooffffffffff ggggggggggaaaaaaaaaassssssssss cccccccccchhhhhhhhhhaaaaaaaaaammmmmmmmmmbbbbbbbbbbeeeeeeeeeerrrrrrrrrrssssssssss are no longer satisfying, effective, necessary, or desirable, we must questions which continue to go unasked by leftists, which be flexible enough to accept it and not force interactions for the are directly linked to that organized and linear mindset, such iiiiiiiiiitttttttttt ffffffffffeeeeeeeeeeeeeeeeeeeellllllllllssssssssss lllllllllliiiiiiiiiikkkkkkkkkkeeeeeeeeee bbbbbbbbbbeeeeeeeeeeiiiiiiiiiinnnnnnnnnngggggggggg eeeeeeeeeennnnnnnnnncccccccccclllllllllloooooooooosssssssssseeeeeeeeeedddddddddd sake of “unity”. There are also different levels of connection and as technology, division of labor, production, etc). As one who wwwwwwwwwwhhhhhhhhhheeeeeeeeeennnnnnnnnn oooooooooonnnnnnnnnncccccccccceeeeeeeeee wwwwwwwwwweeeeeeeeee wwwwwwwwwweeeeeeeeeerrrrrrrrrreeeeeeeeee ffffffffffrrrrrrrrrreeeeeeeeeeeeeeeeeeee commitment to each other which may change over time, and it is prioritizes autonomy and bioregionalism as vital anarchist iiiiiiiiiitttttttttt ssssssssssoooooooooouuuuuuuuuunnnnnnnnnnddddddddddssssssssss lllllllllliiiiiiiiiikkkkkkkkkkeeeeeeeeee tttttttttthhhhhhhhhheeeeeeeeee ssssssssssccccccccccrrrrrrrrrreeeeeeeeeeaaaaaaaaaammmmmmmmmmssssssssss ooooooooooffffffffff aaaaaaaaaannnnnnnnnniiiiiiiiiimmmmmmmmmmaaaaaaaaaallllllllllssssssssss aaaaaaaaaannnnnnnnnndddddddddd important to be able to distinguish between true affinity and a perspectives, I feel that strength will not come from a nostalgic need to keep things going down a dead end road. The monolithic mass of ideology, but from a multi-dimensional tttttttttthhhhhhhhhheeeeeeeeee vvvvvvvvvvooooooooooiiiiiiiiiicccccccccceeeeeeeeeessssssssss ooooooooooffffffffff sssssssssscccccccccciiiiiiiiiieeeeeeeeeennnnnnnnnnttttttttttiiiiiiiiiissssssssssttttttttttssssssssss aaaaaaaaaannnnnnnnnndddddddddd CCCCCCCCCCEEEEEEEEEEOOOOOOOOOOssssssssss wwwwwwwwwwhhhhhhhhhhoooooooooo ttttttttttrrrrrrrrrryyyyyyyyyy ttttttttttoooooooooo jjjjjjjjjjuuuuuuuuuussssssssssttttttttttiiiiiiiiiiffffffffffyyyyyyyyyy organic dynamics of relating to others can begin to take on a more explosion of infinite passions. iiiiiiiiiitttttttttt iiiiiiiiiissssssssss tttttttttthhhhhhhhhheeeeeeeeee wwwwwwwwwwoooooooooollllllllllvvvvvvvvvveeeeeeeeeessssssssss tttttttttthhhhhhhhhhaaaaaaaaaatttttttttt aaaaaaaaaarrrrrrrrrreeeeeeeeee ggggggggggoooooooooonnnnnnnnnneeeeeeeeee natural form then the left or “radical” movements are used to, and “You’ve heard my story about the divisions . . . They aaaaaaaaaannnnnnnnnndddddddddd tttttttttthhhhhhhhhheeeeeeeeee mmmmmmmmmmyyyyyyyyyytttttttttthhhhhhhhhhssssssssss tttttttttthhhhhhhhhhaaaaaaaaaatttttttttt rrrrrrrrrreeeeeeeeeemmmmmmmmmmaaaaaaaaaaiiiiiiiiiinnnnnnnnnn this will often be met with hostility and misconceptions of a “lack of always talk about unity, unity; but I always say, if you solidarity”. In fact, by relating to people on more meaningful levels, iiiiiiiiiitttttttttt ssssssssssmmmmmmmmmmeeeeeeeeeellllllllllllllllllllssssssssss lllllllllliiiiiiiiiikkkkkkkkkkeeeeeeeeee bbbbbbbbbbuuuuuuuuuurrrrrrrrrrnnnnnnnnnniiiiiiiiiinnnnnnnnnngggggggggg ggggggggggaaaaaaaaaassssssssss ffffffffffuuuuuuuuuummmmmmmmmmeeeeeeeeeessssssssss were the army, and the school, and the head of the health we are in far greater solidarity (more effective and relevant to aaaaaaaaaannnnnnnnnndddddddddd bbbbbbbbbbuuuuuuuuuurrrrrrrrrrnnnnnnnnnniiiiiiiiiinnnnnnnnnngggggggggg fffffffffflllllllllleeeeeeeeeesssssssssshhhhhhhhhh revolutionary struggle) institutions, and the head of the govern- iiiiiiiiiitttttttttt llllllllllooooooooooooooooooookkkkkkkkkkssssssssss lllllllllliiiiiiiiiikkkkkkkkkkeeeeeeeeee ssssssssssttttttttttrrrrrrrrrreeeeeeeeeeaaaaaaaaaammmmmmmmmmssssssssss ooooooooooffffffffff jjjjjjjjjjeeeeeeeeeetttttttttt eeeeeeeeeexxxxxxxxxxhhhhhhhhhhaaaaaaaaaauuuuuuuuuusssssssssstttttttttt aaaaaaaaaaccccccccccrrrrrrrrrroooooooooossssssssssssssssssss tttttttttthhhhhhhhhheeeeeeeeee sssssssssskkkkkkkkkkyyyyyyyyyy than the typical superficial ment, and you had “activist” relationships. iiiiiiiiiinnnnnnnnnnsssssssssstttttttttteeeeeeeeeeaaaaaaaaaadddddddddd ooooooooooffffffffff tttttttttthhhhhhhhhheeeeeeeeee wwwwwwwwwwhhhhhhhhhhiiiiiiiiiitttttttttteeeeeeeeee cccccccccclllllllllloooooooooouuuuuuuuuuddddddddddssssssssss aaaaaaaaaannnnnnnnnndddddddddd ssssssssssttttttttttaaaaaaaaaarrrrrrrrrrssssssssss,,,,,,,,,, your guns, which I wish to relate to people as aaaaaaaaaannnnnnnnnndddddddddd ppppppppppiiiiiiiiiiggggggggggeeeeeeeeeeoooooooooonnnnnnnnnnssssssssss tttttttttthhhhhhhhhhaaaaaaaaaatttttttttt uuuuuuuuuusssssssssseeeeeeeeeedddddddddd ttttttttttoooooooooo ffffffffffllllllllllyyyyyyyyyy bbbbbbbbbbyyyyyyyyyy people, and not necessarily would you rather see come through the iiiiiiiiiitttttttttt’ssssssssss tttttttttthhhhhhhhhheeeeeeeeee ffffffffffeeeeeeeeeeeeeeeeeeeelllllllllliiiiiiiiiinnnnnnnnnngggggggggg IIIIIIIIII ggggggggggeeeeeeeeeetttttttttt,,,,,,,,,, in a political way. I think for door, one lion, deeper connections and wwwwwwwwwwhhhhhhhhhheeeeeeeeeennnnnnnnnn IIIIIIIIII sssssssssseeeeeeeeeeeeeeeeeeee tttttttttthhhhhhhhhhaaaaaaaaaatttttttttt EEEEEEEEEEaaaaaaaaaarrrrrrrrrrtttttttttthhhhhhhhhh wwwwwwwwwwiiiiiiiiiillllllllllllllllllll ssssssssssoooooooooooooooooooonnnnnnnnnn bbbbbbbbbbeeeeeeeeee ddddddddddeeeeeeeeeeaaaaaaaaaadddddddddd unified, or 500 understanding of one aaaaaaaaaannnnnnnnnndddddddddd aaaaaaaaaammmmmmmmmm ttttttttttoooooooooolllllllllldddddddddd tttttttttthhhhhhhhhhaaaaaaaaaatttttttttt IIIIIIIIII aaaaaaaaaammmmmmmmmm oooooooooovvvvvvvvvveeeeeeeeeerrrrrrrrrr rrrrrrrrrreeeeeeeeeeaaaaaaaaaaccccccccccttttttttttiiiiiiiiiinnnnnnnnnngggggggggg another, it is helpful to mice? My answer is 500 mice can aaaaaaaaaannnnnnnnnndddddddddd ffffffffffoooooooooorrrrrrrrrrcccccccccceeeeeeeeeedddddddddd qqqqqqqqqquuuuuuuuuuiiiiiiiiiieeeeeeeeeetttttttttt bbbbbbbbbbyyyyyyyyyy tttttttttthhhhhhhhhheeeeeeeeee TTTTTTTTTT..........VVVVVVVVVV..........,,,,,,,,,, ppppppppppiiiiiiiiiillllllllllllllllllllssssssssss,,,,,,,,,, tttttttttteeeeeeeeeeaaaaaaaaaacccccccccchhhhhhhhhheeeeeeeeeerrrrrrrrrrssssssssss,,,,,,,,,, aaaaaaaaaannnnnnnnnndddddddddd transcend politics. Yes, it’s do lots of damage political that some people ppppppppppssssssssssyyyyyyyyyycccccccccchhhhhhhhhhoooooooooollllllllllooooooooooggggggggggiiiiiiiiiissssssssssttttttttttssssssssss and disruption.” have control of the land, iiiiiiiiiitttttttttt iiiiiiiiiissssssssss tttttttttthhhhhhhhhheeeeeeeeee ffffffffffaaaaaaaaaarrrrrrrrrrmmmmmmmmmmssssssssss ooooooooooffffffffff wwwwwwwwwwhhhhhhhhhheeeeeeeeeeaaaaaaaaaatttttttttt,,,,,,,,,, food, and water, but it won’t - Born In Flames wwwwwwwwwwhhhhhhhhhheeeeeeeeeerrrrrrrrrreeeeeeeeee ffffffffffoooooooooorrrrrrrrrreeeeeeeeeessssssssssttttttttttssssssssss ooooooooooffffffffff pppppppppplllllllllleeeeeeeeeennnnnnnnnnttttttttttyyyyyyyyyy oooooooooonnnnnnnnnncccccccccceeeeeeeeee ddddddddddiiiiiiiiiidddddddddd ggggggggggrrrrrrrrrroooooooooowwwwwwwwww be politics which changes that. Too often, the Left has * This article is part of IIIIIIIIII ccccccccccaaaaaaaaaannnnnnnnnn’tttttttttt tttttttttteeeeeeeeeellllllllllllllllllll yyyyyyyyyyoooooooooouuuuuuuuuu wwwwwwwwwwhhhhhhhhhhaaaaaaaaaatttttttttt cccccccccciiiiiiiiiivvvvvvvvvviiiiiiiiiilllllllllliiiiiiiiiizzzzzzzzzzaaaaaaaaaattttttttttiiiiiiiiiioooooooooonnnnnnnnnn iiiiiiiiiissssssssss,,,,,,,,,, alienated (and in some cases a series written for the nnnnnnnnnnooooooooootttttttttt iiiiiiiiiinnnnnnnnnn iiiiiiiiiittttttttttssssssssss oooooooooowwwwwwwwwwnnnnnnnnnn llllllllllaaaaaaaaaannnnnnnnnngggggggggguuuuuuuuuuaaaaaaaaaaggggggggggeeeeeeeeee purged, fought against, and even slaughtered) those they see as insurrectionary green anarchist publication, “DISORDERLY bbbbbbbbbbuuuuuuuuuutttttttttt IIIIIIIIII kkkkkkkkkknnnnnnnnnnoooooooooowwwwwwwwww iiiiiiiiiitttttttttt wwwwwwwwwwhhhhhhhhhheeeeeeeeeennnnnnnnnn IIIIIIIIII sssssssssseeeeeeeeeeeeeeeeeeee iiiiiiiiiitttttttttt the “other”, meaning those who do not blindly accept the ideologies, CONDUCT”. This part is taken from the newly released Winter/Spring ideals, and morals of the Left or “Progressives” as righteous and (#6) issue, available from the Green Anarchy Distro. Future iiiiiiiiiitttttttttt llllllllllooooooooooooooooooookkkkkkkkkkssssssssss lllllllllliiiiiiiiiikkkkkkkkkkeeeeeeeeee aaaaaaaaaa ssssssssssccccccccccaaaaaaaaaarrrrrrrrrr oooooooooonnnnnnnnnn tttttttttthhhhhhhhhheeeeeeeeee llllllllllaaaaaaaaaannnnnnnnnndddddddddd “good”. Most people do not relate to the “Left vs. Right” duality. parts of “NOT MY VISION” will address workerism, wwwwwwwwwwhhhhhhhhhheeeeeeeeeerrrrrrrrrreeeeeeeeee ttttttttttrrrrrrrrrreeeeeeeeeeeeeeeeeeeessssssssss uuuuuuuuuusssssssssseeeeeeeeeedddddddddd ttttttttttoooooooooo ssssssssssttttttttttaaaaaaaaaannnnnnnnnndddddddddd These terms are both part of the same system, and are therefore anarcho-communism, anarcho-liberalism, anti-ecological or --JJJJJJJJJJooooooooooeeeeeeeeee meaningless distinctions. Both have a long history of supporting anti-bioregional perspectives, techno-nerds, identity politics, and their ideological stance with authoritarian, and often state other orientations and persuasions within the anarchist movement. page 7 GGGGGGrrrrrreeeeeeeeeeeennnnnn AAAAAAnnnnnnaaaaaarrrrrrcccccchhhhhhyyyyyy ######111111111111 DDDDDAAAAAYYYYY 1111166666::::: IF YOU CUT THE SYSTEM, Homo-Sapiens are no less an animal IIIIITTTTT BBBBBLLLLLEEEEEEEEEEDDDDDSSSSS AAAAANNNNNAAAAARRRRRCCCCCHHHHHYYYYY species than other beasts we walk with. More specifically, we are a pack species, These beasts, the stupidest of all beasts, have gone so far as to believe we give it with our fears. The lines are not mathematically straight, the mammalian and themselves the rulers of this world. As though their raging little battle of circles are not perfect. It’s just another illusion of order, just another skin simian. Call the “man against nature” has actually been won. They don their skins of to hide the inescapable chaos beneath. This chaos is intrinsic to all energy, pack a band, tribe, authority—synthetic/polyester cop suits with a shiny hunk of metal pinned mass, motion and time. It is the random, passionate, anarchistic force that gang, clique, racial to the chest. They grasp with thumbs tools that kill, maim and detain, as is even scientifically shown to be the nature of all things. This chaos is life. genderific socio-eco- well as an array of tools for the infliction of pain. How scared of us they This chaos is freedom. Live and be free. nomic clubhouse or must be to require such an arsenal to walk our streets. Mace, nightstick, With peace when possible and passion always, country. Call it what- flashlight/club, gun, two extra clips and the ability to summon even more TTTTTrrrrraaaaavvvvveeeeellllleeeeerrrrr..... ever you want. There techno-mechanical reinforcement with relative efficiency. But man is a are many who believe us to be somehow special, perhaps for our bulging brief candle while the goddess is internal, external and eternal. So frightened brainspans. The homosapien uses 10% of its brain on average while most they seem in their skins. I can see it in their eyes. NOTE: On October 11th, a mysterious man known only other species use 80-90%, so while the per-mass brain size is smaller, We don’t need another “organized revolution”, as they all seem to be as “Traveler” climbed up an old cedar tree in down- they still use more of theirs than we do of ours. Sadly, this makes us the followed by yet another government that in the end can’t be trusted, requiring town Eugene, Oregon. He squatted on a platform atop the tree for twenty days to draw attention to stupidest creatures on the face of the Earth, explaining why we are the yet another revolution. It has been this way throughout history. Look at the the city’s war against homeless campers. Prior to only ones who consume out of balance with our environment, destroying streets and see the chaos that already lurks beneath the fleshless skin of the tree-squat he had helped to maintain a protest/camp that which sustains us. order, look into the eyes of passers-by and see the fear. Sacred ways of life on the doorsteps of city hall. The war on homeless Whatever-who knows, who cares. There is no future but the moment, no used to be lived out on the same land that is now city, suburb, farm, factory. folks is old, and has been a primary tool used to keep past but what we carry in the present. We exist right here, right now. Our Rivers underneath mud from clear-cut-landslides, beaches under resorts, people in check since the dawn of civilization. The bodies need food, water and sleep, nothing more. Our spirit needs love and and mountains mined and plundered reside beneath toxic waste landfills. most basic human need is warmth and shelter, so it our soul doesn’t need a goddamned thing. This is who we are, where we are, The spaces that once enriched and empowered our lives as animals are is vital for the hierarchy to control what we are. We are a passionate species, and in our heart burns a chaotic now barren techno-wastelands we are disgusted to “take back” as our own, this. We commend Traveler for fire that guides our emotions and mind via the injection of adrenaline, phero- except to the extent it helps us to sledgehammer these layers of proverbial fighting on this frontline, at risk to life and limb. Currently, mones and other lovely internal pharmaceuticals that push and pull us into concrete. To claim what is ours, to claim what can be found in the cracks in Traveler is helping the external expressions of our animalistic natures. No complaints. the sidewalk, claim it in your heart and mind, your body and soul and then to create an autono- Even this dreaded “system,” this orderly infestation, is nothing more from any motherfucker that tries to take it from you. It is important to fear mous tent village in than a pack of frightened little creatures, huddled in the distance, clinging not to die, but it is more important to fear not to live, to see that all one Eugene. desperately to their tools and false skins. If you prick the system, it gets needs to be free is to realize that you already are. scared. If you cut it, it bleeds anarchy. It is not the great, single-minded Don’t wait around for the little white man to light up, giving you permission predator so many fear. It is only a few fearful little monkeys, hiding to cross the street. Use your eyes, your ears, your mind—are there any behind skins that give the illusion of order and tools that give the illusion cars? No. Are there any cops? No. And cross the damned street. A people of power. These frightened creatures, these cowards hide from you and who suffer through tyranny are a people who accept tyranny. We are free as me, but even more so they hide from us. They know what many of us soon as we wake up and realize this nightmare world of encroaching straight- seem not to realize: there are more of us. Many, many more. lined, perfect-circle order is only that, a bad dream having only the power TTTTTTTTTTHHHHHHHHHHEEEEEEEEEE PPPPPEEEEEOOOOOPPPPPLLLLLEEEEE ’SSSSS VVVVVVVVVVEEEEEEEEEENNNNNNNNNNGGGGGGGGGGEEEEEEEEEEAAAAAAAAAANNNNNNNNNNCCCCCCCCCCEEEEEEEEEE!!!!!!!!!! ANTI-CAPITALIST/ANTI-IMPERIALIST/ ANTI-GLOBALIZATION/ANTI-WAR RESISTANCE September 9-12, Chile: Marchers October 5, Greece: Protesters Dis- Bergen said the vandalism could detract September 6, Puerto Protest During Coup Anniversary rupt EU Summit In Protest Of from his group’s anti-war message by Rico: Protesters, drawing attention away from the Santiago: Pigs used tear gas & water Capitalism & Imperialism Navy Clash During debate (debate?) over Iraq. “No one cannons to disperse crowds during a Rethymnon: In this town of the Crete Demonstration associated with us would do something march marking the 29th anniversary of islands, approximately 250 protesters Vieques: Navy the military coup led by Gen. Augusto (anarchists, leftists & students) like this. We use more direct ways to security officers fired Pinochet. While most of the 1,500 assembled outside the Creta Hotel, get our point across that are less alien- Empire continues to spread, rapidly tear gas at protesters who hurled rocks demonstrators marched passively some where the EU. defense ministers sum- ating to other people.” While graffiti consuming first indigenous peoples, over a fence during bombing exercises 25 blocks from downtown to the main mit took place. The protesters chanted may be a symbolic act of protest, it is and now, with nearly all of them on the island of Vieques, authorities cemetery, small groups of masked against NATO, the US government and a direct means of communicating ideas. either wiped out completely or said. 2 servicemen were hit by rocks youth started throwing rocks & Molotov the EU The riot policemen attacked with As long as people continue to appeal assimilated into the dominant para- but were not injured in the confrontation. cocktails at stores, bank offices, and batons, and some protesters hit back for “rights”, or beg the system for any- digm, other cultures that are not yet The security officers, assigned to police. Several banks and a McDonald’s with sticks. While thing they want, they will scolanvfeosrm oris mt ciorrnosrus mofe trh sep Uecntiatecdle S. Ttahotesse’ glgaaunasd ra dat n add e fame pnorcnoest tebrasettetowrrsse’ wecanhm osp two, efleirreen duN staeinvagyr rmpeaasltraacchue r,aw nweth nwitc hep rewa savtsa ntdhdeeas ltiprzoereydes. idd Aebsny ttiahaierl wmwaeitnrheyd ratswhtorionnwegns, orthefe m spaloaisvniet iroiynn. whose ways of living are not fully slingshots to throw rocks. It was force jets during the coup, demonstrators against the cops. Rights are reliant on capitalism are erased or unclear how many protesters were burned a US flag. It is widely believed After the police given to you forced to don the costumes of the involved. Military exercises continued the US government & the CIA supported viewed the video footage by the government; colonizers, the iron masks of the Euro- after the clash, with a Navy destroyer the coup. September 11 itself began they acquired during the sum- freedom is taken. Trying American empire. While suburbanites as well as a squadron of F-14s & F-18s with a planned tribute to Salvador mit protests, 60 anarchists were to influence control mow their lawns and drive SUVs from firing “inert” 5 inch shells & flare tracers Allende at the monument established arrested and released over decisions gated “communities” to the corner upon an defenseless shore. G W II in his honor across from La Moneda, after questioning. made by store, there are earthquakes of has promised the Navy will withdraw where he “committed suicide” (or more authority revolt, the rumblings of which will from the island by May 2003, but accurately, was killed) during the Oct 7, Oregon: only serves sooner or later be felt on our sacred continues to use the island as target Pinochet military coup. The event was A n t i - W a r to demean shores. As the work toward the practice. 3 exercises have taken place suspended after members of the youth Graffiti Found and under- cboanctkrloals ho gf roawlls leiqfeu apllryo sgtrroensgse. Ms,a ay tahtetarec ks inscueb Sm1a1r,i ninevso,l vainngd 1a0b sohuipt s8, 02 sthercetiwo ne ogf gthse aCnhidle apna iCnotm bmoumnibsts P aarntdy On Capital minitneeg riotyu.r it continue and grow to destroy all planes. Vieques is just one example exchanged blows and insults with Portland: Peaceful of US arrogance in regards to non- members of the Socialist Party. The ”Vandals” spray- protests colonizers, all imperialists, and human life, seeing land devoid of Socialists whined about the communists painted anti-war and dem- finally civilization itself. Once the human life as physically attacking them and tried to slogans and pro- onstrations path to freedom is discovered, it can suitable for keep them from approaching the fanities across the front of the state are hopelessly symbolic acts that are reveal to us the way out of all adolescent, monument. We have no idea what capital Saturday night, hours after a akin to asking your master for some token domination, imperialism and truly these two authoritarian leftist sects protest march that drew an estimated amount of liberty. and capitalism, as destructive, were fighting about, except maybe a 6,000 people. State crews spent hours spring eases us behavior. shared, competitive desire to be running Sunday morning trying to cover up the October 14, California: Arson Attack from winter to the government (Allende was a member letters and keeping the paint from at Military Recruiting Station summer. of the Socialist Party, as is Chile’s penetrating the marble walls. Additional San Jose: San Jose & federal investi- current president, Richard Lagos). graffiti was found on the side of the gators are investigating an early morning Police arrested 445 people over the Public Service building. The messages fire which involved anti-government course of the night and into September included derogatory comments about graffiti. San Jose arson investigators 12 as protesters built barricades across acting President Bush, the war with called the Federal Bureau of Alcohol, the streets and lit fires in Santiago’s Iraq, an anarchy symbol, and other Tobacco, & Firearms to examine the working class suburbs. Bullets state and police criticism. Peter Bergen, remains of a blaze at a military recruiting wounded four police agents. executive director (hierarchy? NO!) of center on Mckee Rd. Officials said 2 Oregon Peace Works, said the vandal- military vehicles were torched, windows ism will only hurt his group’s effort to were smashed, and graffiti was found ““CCIIVVIILLIIZZAATTIIOONN iiss aa DDEEAATTHH CCAAMMPP promote peace. “It’s not going to at the scene. No arrests have been . . .remember the Warsaw ghetto uprising!” help, it’s not the kind of thing we do reported and a cause or damage estimate and we don’t support that at all.” was unavailable at the time of this - awesome, inspired graffitti found at the Keystone Cafe bathroom. GGGGGGrrrrrreeeeeeeeeeeennnnnn AAAAAAnnnnnnaaaaaarrrrrrcccccchhhhhhyyyyyy ######111111111111 page 8 article. However, the lone graffiti at greed, the US cries “encore” and showers November 24-31, South Korea: South TTTTTThhhhhheeeeee UUUUUUnnnnnnddddddeeeeeerrrrrr------ the scene consisted of the words “pre- the stage with gifts of money and guns. Koreans Are Sick Of Americans emptive attack” spray painted in red Thus it was with Iraq when Hussien Seoul: Some restaurants and pubs in on the side of the building near the knew his place within the international entrance. It is encouraging to see a State-crime syndicate. But time made the South Korean capital are refusing ccccccoooooovvvvvveeeeeerrrrrr SSSSSSttttttaaaaaatttttteeeeee to serve Americans amid anger over the stepped up level of offensive protest the lovers restless, and now Iraq is a acquittal of two US soldiers for the road against military authority, especially blood-clotted doormat on the path to deaths of two teenage girls. “Americans considering the anti-war movement’s future conquests: some 200,000 killed are not welcome here,” read a sign on continually stagnant and ineffectual in the orgy of Desert Storm, perhaps a demonstrations for “peace”. Besides, million and a half more (mostly children the door and a window of a restaurant bbyy LLaavvaa FFllooww in Seoul. On November 24, a US military it is high time people start to realize under the age of 5) felled by genocidal court cleared Sergeant Fernando Nino that whether or not the US government sanctions, and yet more by persistent and Sergeant Mark Walker of negligent is “officially” at war with another country air strikes that form the decade’s wall- homicide, but anti-US protesters said or not, it is constantly waging violent paper. It is no longer enough for us to the verdict was a sham. “I don’t want military action to give a drop against countries of water to and movements all Picture this: almost half of your town’s population has become Americans,” over the world, undercover police officers and most of your friends are harassed said one restau- everyday. Those and attacked by them. Imagine that two out of five emergency room rant owner. people wanting free- Some protests visits are now because of police violence. That the non-police half dom and autonomy have turned of the populace are now living in constant wariness. You yourself from imperialist violent, with have stopped going outside after dark. Your roommate has been forces, those who Molotov cock- acting strange and you suspect him of being an agent... simply want to be tails being Would you consider this a state of emergency? Low-level warfare? left out of the new thrown into Would you deem this political or would it seem personal, a matter world order and left military bases. between the individuals involved? alone will not be, as On November long as the consuming Well, let me lay some statistics on you, and I quote my T-shirt: In the 28, two fire- force of civilization USA half of all women experience an intimate relationship with an bombs were exists to hunger at abuser, one in four women are raped by their male “date,” every nine thrown over the resources and seconds a man beats a woman, a man rapes 1 out of 3 women, a male wall of Camp markets. Civiliza- Page in the partner kills a woman every two hours. tion has been at war eastern city of How does this touch my life? A painter friend tells me her father with the wild for Chuncheon. On raped her and her sister all their childhood, a musician friend says a more than 10,000 years and organizing denounce the murderous policies of Bush/ November 30, about 2000 students in man raped her with a knife, a writer mourns her friend, left on the peaceful protests has never stopped it, Cheney and the whole parade of rotting Seoul marched with candles and burned side of the road, drugged, raped and killed. My friends strip so they nor will it. The seemingly imminent war suits in the White House. These socio- an American flag. Thousands of riot can make as much money as some “real worker” guy who drives the with Iraq is a single issue. Trying to stop paths need to be bodily dragged from police armed with helmets and plastic the war with Iraq is pointless if we do their seats of power, weighed down with road repair machinery. And I am walking around after dusk curfew, shields kept close watch on the not try and stop the larger and ever a red stone for every lost life that can be aside from me, the pedestrians are all men, comfortable men, sauntering protesters to block them from marching pervasive war against the wild, laid at their feet, and thrown into the around, thinking their own private thoughts, maybe stoned, maybe to the embassy. 50 female activists, autonomous freedom, and life. most unforgiving depths of the sea. drunk, at home in a world made for them. Perhaps a police car drives dressed in white traditional Korean Commodified business as usual, with funeral clothes, sang anti-US songs. A by and they momentarily freeze. Oh, if all I had to fear was a the US government at war or not, is still November 24, South Korea: sorcerer danced and performed a ritual uniformed man in a brightly marked car! war. It is war against life! The “peace Firebombs Hurled At US Base for the dead girls. Dozens of motorists Do you have a class-based analysis? I’ll quote United Nations movement” is simply a movement based Seoul: Dozens of activists hurled fire- blared their honks as they passed by figures: Women do 70% of the world’s work, earn 10% of the upon privilege, a movement to keep the bombs into a US military base protesting the US Embassy which was guarded by world’s pay and own 1% of the world’s property. But how easily status quo in order so that the appar- last week’s acquittals of two American hundreds of South Korean riot police. despised is the rich woman in furs who is buying the stairway to ently not yet too- dwindled middle class soldiers involved in the deaths of two can try and eke out yet another Korean teenagers. The attack on Camp heaven? Like the corporate receptionist, she is a buffer between us generation of exploited material comfort. Gray in Seoul, a small warehouse and the rich elite males. Women and children are 80% of the home- management facility manned mostly by less in this nation. Women and children are an economic class or caste November 10: Belgium Anti-War South Korean employees, caused no in themselves. So much for the noble burly-man worker of the world. Protest Turns Violent property damage or injuries, the US Sometimes I see the pyramid of control more like an iceberg. The Brussels: A protest march of at least military said. Last week, Sgt. Fernando visible tip is the corporate state, rich men and uniformed men doing 1,500 demonstrators against war in Nino and Sgt. Mark Walker were acquitted violence to other men. But the state is a formulation of the father- Iraq turned violent in downtown Brussels of negligent homicide charges in the controlled family unit. The huge, underwater part of that state consists when dozens of youths clashed with deaths of two 13-year-old school girls, of men who police women at home, work, on the streets. The obvious police and attacked American-owned who were hit June 13 by an armored agents of force need only be relatively few because men are doing the businesses. Masked, stone-throwing vehicle. The acquittals prompted an work of the state, terrorizing (or supporting the terror with silence) and radicals broke windows at a outcry from South Korean activists, who McDonald’s fast food restaurant and a called the trials a sham. Walker and keeping the majority of the population — women and children — in line. Marriot hotel, as well as a local Nino, who belong to the 2nd US Infantry Without male supremacy, the state would be impossible. But the temporary employment agency. Only Division, were on a training mission collapse of the state can and does leave male supremacy intact. minor damage was done, however, as when their vehicle struck the girls on a This is why anarchy without feminism has been called reformist. riot police moved in, backed by water narrow rural road. The girls were on Perhaps you will learn more about feminism. And when you hear cannons. The rioting began when up their way to a birthday party. About “smash the state” you’ll think about the undercover state, about what to 100 youths broke away from the main 37,000 American soldiers are based in isn’t being said and how you’re going to say it. body of the anti-war protesters who South Korea as a “deterrent” against were marching through the city center. communist North Korea. Both the US the blood is the currency They hurled stones at businesses and and South Korean governments favor by which we trade our destinies police, who responded with baton an American military presence as a CCCCCUUUUURRRRRRRRRREEEEENNNNNCCCCCYYYYY charges. Photographers and TV camera deterrent against the communist North. propels operators were also targeted by the But the South Korean people are sick some to be takers on this world rioters. Police said 1,500 protesters of America’s imperialist presence. The where comprising pro-Palestinian and anti- 1950-1953 Korean War ended without capitalist groups joined the demonstration a peace treaty. BY DIAN MILLION racial memories are named for led by a banner reading “Stop USA.” the taker: March organizers said some 5,000 November 27, Seattle: Corporations people actually took part. These are Targeted For Anniversary Of The Sand Creek watching our exactly the sort of actions that need to Battle Of Seattle Bosque Redondo be happening in the streets of America blood The following is a communiqué that Auschwitz every fucking day, not more “peace” was released to the corporate press: its journey into plasma bags vigils, and not more “days of Cape Town Resistance to corporate dictatorship is mourning”(the only thing we’re laying still on tables on the rise, in Seattle and globally. From personally mourning about September Argentina, to Palestine, our movement hearing the coughs and restless the lives we remember individually 11 is that casualties at the Pentagon weren’t higher.) The US breathes war, is growing. Specific businesses in Seattle movements from have been targeted. A few months ago, being the largest arms dealer in the of people bleeding for the wars fought for money Starbuck’s got five windows knocked out. world, being the world’s strongest military Tully’s got 14 windows busted. And last the seven dollars to run strip mining force, being an economy that relies on night, the Gap on Broadway got spray- military spending for the development which sends us out again take the land painted, and it’s locks glued shut. These of the technology sector, and being the businesses were all targeted for their able to face looking for something erase entire peoples. club-happy cop that readily employs genocidal brutality to expand the continued and ruthless exploitation of the this earth and its inhabitants. This behavior No one left untouched economic prospects for itself and its deep partners in crime. The US has a will not be tolerated. In the coming days, yet some resistance will grow, in many forms. Of red fluid that propels our hearts bloodlust for Iraq, having made it the remain silent not told course, none of the journalists covering first spectacular casualty of the New World Order, crushing it underfoot for this story will do so in a comprehensive war is money that our blood is currency way, to do so would go against your a decade, and mechanically plotting to the blood spilled to the earth that societal role. Why not do something rain yet more horror on its people. different for a change, and question the blood appearing suddenly with no warning for seven dollars When America’s friends—Israel, corporations as much as you question the Indonesia, Turkey, and the rest of the from wounds that we inflict on one or for seven billion “radicals”. The Struggle Continues! pack—invade neighbors or sacrifice - Unknown another it will never buy one thing back. their own people on Moloch’s altar of page 9 GGGGGGrrrrrreeeeeeeeeeeennnnnn AAAAAAnnnnnnaaaaaarrrrrrcccccchhhhhhyyyyyy ######111111111111 GGGGGUUUUUEEEEERRRRRRRRRRIIIIILLLLLLLLLLEEEEERRRRROOOOOSSSSS dddddeeeee LLLLLEEEEE NNNNNOOOOOCCCCCHHHHHEEEEE !!!!! EARTH AND ANIMAL LIBERATION ACTIONS FROM LOCAL AND DISTANT BIOREGIONS animal, these squalid conditions A total of 18 rabbits were rescued and compensation claims with the Indian produce a perpetual state of chronic all of them have now been placed in government, many of which are caught distress, unimaginable to human new homes. All the rabbits had over- up in legal wrangling and red tape. The beings. This stress leads to severe grown claws, infections and others Indian government promised to seek psychosomatic illness, causing disturbing diseases but with the help of sympa- the extradition of Anderson after a court behaviors like self-mutilation, cannibalism, thetic vets they will all survive. In their in Bhopal in September rejected a and incessant pacing and scratching in new homes they will be given a chance request by federal prosecutors to attempts to escape from their prison. to dig, jump, run, eat fresh food and reduce the charge against him to unthivginerrgessee n ww aihlndiac ahrnc adhr yfer e(fgreer. ee2 ea.n n vda.n tw’h.ieel rda..kcit.i)o nns. 1a.n adl lm polavceems,e pnetsr soofn tsh,e or Afaaessibloinnueflm ltdstaepy heeekep,ceeir n fl ttiilrpaeihennritooxeertdiipet,ercid e, iresnu n t.lt usryt hhoitsie eIhevefief dneney tyf c ,hu t ss oc iheluanonaofe cgtmenmrrehy efset niih schn n mo.aaeseek nTtra vmiabsehdetnheyelhi ni te nssgeeiottdotehreern, n we cfrnastoigeihhnne,rrla eegd lotshsnni n rohachs ealteatylaehfncha levkdcteolteoyhys,r,f amdch“taddhAaineooramenerd.c ,ka i i fU mtedaalrchnle ersaaetfum-olhdlphep r”are oaett t bwtu oimbtpovnuh eb de easiitrinon et eht1eg sw ro sap”8lishysd,e a be ea“oew iim dn f wtrle itea utoate ihfbc.rlfntd dole b Sp d.ebu ilda Arotlrehdae eisghihn brs ofala”itoe bnn hwsnanidnlo stynaog dsu dw rl s,rias k biue“teb gsteCch uohthwalreohta t lh imeassttttieeooohyss. SE “smhiV ncoo iLie VartImnFgnenau, diti Isnscwn si iiidain IdnhaSna egoIsuc:nl, is r”dfdsnA ea prhceitecaaeataeec assottesc hehrcn tneue ek btptfD lsudhcyy stare O onaess c etdemn2hrg u0 taoDaolc ripykgg taee eeiespcvna enapoeercvsefdllee loa“i y.rmcir”pan;u i p AlnmlT 1prs nhic9apsedoe9booneu2lnrretrtt-.- witnessed all of these things and more Every second means resistance. utility vehicles and area construction just as disturbing, first hand at this - Djurens Befrielse Front (Swedish ALF) sites, leaving local police and FBI August 31, England: There has been no claim in responsibility farm, and feel that they must pose this investigators wondering if the acts are Peat Moss Profiteers Attacked! for the Pedigo bay incident, conflicting question to the public. Would this December 3, Holland: Fire-Bombing linked to a radical environmental group. Doncaster: Two-thirds of Scotts peat with the history of ELF actions in deplorable situation be allowed to Against Horse Exploitation At least four incidents in recent weeks moss stock was destroyed in one night, the area. continue if the animals happened to Den Haag: The following communique in Henrico and Goochland counties when a small group of people visited be cats, or puppies perhaps, rather was received by the Dutch ALF Press have prompted authorities to look more Hatfield Peatworks near Doncaster and November 8, France: than their canine relative the North Office: ALF attacked Goa’s horse musical closely at the international under- slashed 3/4 of Scotts bagged peat Arsonists Attack McDonald’s American Mink? Clearly, it would not. in Den Haag. A total of four fire bombs ground earth liberation movement. In moss. Based on figures by Scotts lawyers Police are investigating an arson Brutality is brutality— these animals are were put under two trucks. One of three of the four local incidents, some- for a previous action of this kind we attack on a McDonald’s restaurant no less deserving of basic “rights” than those trucks was heavily damaged one has left a note or message estimate that over 100,000 pounds under construction in eastern France. the animals we call our friends, and the because of the fire. Unfortunately the suggesting “ELF” was responsible for worth of damage was done. Note: peat The restaurant was destroyed by fire law protects as such. Thus it is, in the other truck survived the attack. We will the damage. In the fourth, the perpe- extraction means the destruction of peat and nobody was injured. Construction face of this glaring hypocrisy, with their learn from this and we will continue trators left a message indicating they marshes which means the destruction of the restaurant was nearly complete very real suffering in mind, that we take our fight! Get out there. Get active. had an “environmental agenda”. The of the fauna and flora which depend on and it was due to open next month. the justice and mercy that the law fails Get underground. - ALF two most recent incidents locally under that eco-system for their very survival. The fire blew out windows, collapsed to provide into our own hands, and investigation occurred Oct. 5 or 6 in the building’s roof and shattered much provide it for those who cannot act in December 3, India: Thousands the Riverlake Colony subdivision in Mid-September, England: of its interior. The fire, which investigators their own defense. The economic value Protest On Anniversary Of Henrico’s far West End. The perpe- McDonalds Gets McDamaged! believe started in the kitchen, came of a dead body or a frivolous luxury Industrial Disaster trators severely damaged two SUVs Reddish: A new McDeath in Reddish amid a heated court battle launched item can not be compared to the Bhopal: Thousands of people held that were parked about a block apart. hasn’t proved too popular with the by residents opposed to the inherent value of a life— thus protest marches and hurled stones at In the 800 block of Colony Bluff Place, locals. Since recently opening it has McDonald’s presence. Residents said unnecessary killing is absolutely a former Union Carbide chemical plant vandals repeatedly sliced the body of been robbed once, broken into several they objected to the odors and unjust. This has been recognized by in the Indian city of Bhopal on the 18th a 1996 Toyota SUV with what police times with all the burgers thrown about increased traffic expected from the much of the rest of the world, and in anniversary of a gas leak that killed said may have been a hatchet, causing and the deep fat friers vandalized, and restaurant’s drive-in service. Other multiple cases, fur farming has been nearly 15,000 people in one of the $8,000 to $10,000 in damage. A note the doors and windows are being McDonald’s restaurants have been completely banned by other “first- world’s worst industrial accidents. The found inside the truck said that ELF was kicked in on a weekly basis! It’s hardly similarly unwelcome in France. Anti- world” governments. It is time for the protesters also burned effigies of responsible. That same night, vandals a surprise considering the outlet was globalization activist Jose Bove rose world’s most accomplished and proven Warren M. Anderson, an American who used a sharp object to dent the body built in the face of local opposition and to fame in1999 when he and nine others terrorist, the United States, to respond was then chairman of Union Carbide, of a 1995 Ford SUV parked in front of a with planning permission from the state used farm equipment to dismantle a and follow suit. If it does not, this and demanded his extradition from the home in the 9900 block of Eildonway on the sly, not to mention McDonald’s McDonald’s branch under construction inexorable struggle on behalf of United States to face trial in an Indian Place. Damage was estimated at reputation for proletariat and animal in Millau, in the foothills of the Massif innocent life will continue. The E.L.F. court. Many gas victims believe India $5,000, and the perpetrator left behind exploitation. Central mountains. took part in this action on behalf of the has never pursued extradition vigor- a note claiming ELF was responsible. Earth, due to the target’s extreme ously because it did not want to About a week earlier, on Sept. 27 or September 17, Indiana: Pedigo November 26, Pennsylvania: pollution of surrounding streams and offend the U.S. government or dis- 28, vandals defaced about 25 Ford and Bay Model Home Completely ELF & ALF Target Fur Farm groundwater with excrement and offal courage multinational corporations Mercury SUVs on the lot of Universal Destroyed, ELF Targeted Harbor Creek: The following communique runoff. The fur trade’s co-dependant from investing in India. In the Dec. 3, Ford at 10751 West Broad Street. A Bloomington: Local environmentalists was sent to both the Animal Liberation relationship with the ecological night- 1984, accident, toxic methyl isocyanate white substance applied to the SUVs, are being harassed by the ATF, the FBI Front and the Earth Liberation Front mare of factory farming and other such gas — an ingredient in pesticides — determined to be glass-etching cream, and Indiana State Fire Marshalls Press Offices: At 2:00 AM on November nefarious forms of animal agriculture permanently scarred the surface of the following a fire that completely destroyed 26, 2002, anonymous cells of the ALF alone, completely necessitate vehicles. In another incident about a $725,000 model home at Pedigo and the ELF visited the Mindek Brothers our action in defense of two months ago in neighboring Bay, the soon-to-be luxury subdivision Fur Farm (4200 Shannon Road) in Harbor life on Earth. If the Goochland County, people on the southeastern shore of Lake Creek, Pennsylvania. Before disappearing owners of the apparently opposed to Monroe, which is also in the town’s into the night, a large fire was set destroyed the construction of an watershed. The fire, which incinerated which completely destroyed the farm’s facility wish to upscale neighborhood the 3,400-square-foot home, is still feed barn and its contents, causing be left alone, near the Hanover County being investigated, but local pigs extensive financial loss. The ALF is also they should line damaged some con- suspect arson as being at the crux of claiming responsibility for releasing permanently struction equipment and the blaze. “We think it was arson and 200 breeding mink in May and 50+ in close their the interior of one of the possibly the ELF group,” said the owner September from the same farm. Working operation, houses. The perpetrators of Pedigo Bay Realty and Development. together, cells from ALF & ELF demolished providing clear left behind a burned U.S. Since 1996 the ELF have been responsible this feed facility due to its role in the proof that they flag. Goochland and for more than $42 million in damage/ systematic torture and killing of have done so. Powhatan authorities creation utilizing arson, property thousands of innocent creatures yearly If this is done said they’ve also received transformation, and tree spiking, among -—animals which possess the same immediately, reports in recent months others, $700,000 of which was attributed complex emotional/physiological traits and this of damage to construction to an arson in February 2000 to the as loved household pets, yet are communique equipment in areas where luxury home of Bloomington resident denied all reasonable consideration is released to state Route 288 is being Vince Scott in Sterling Woods. In an ELF and confined to a miserable “existence” the public un- built. In Powhatan, the communiqué sent to local TV & radio in tiny wire cages hardly large enough altered, individual perpetrators poured substances stations the day after the blaze, the to turn around in. Imprisoned in fur members from each of into the diesel fuel tanks of group stated, “The house was targeted factories, these solitary creatures are the cells responsible for several earth movers. No because the sprawling development forced to endure intensive confinement this action will turn themselves messages or ELF-related calling cards, it is located in is in the Lake Monroe for the entirety of their lives, next to, in. If this is not done, the rest of the leaked from however, were found at the 288 Watershed. This is the drinking water or not uncommonly, packed into the mink ranch will be demolished. Other Union Carbide’s pesticide construction sites. In another incident supply for the town of Bloomington, Ind. same excrement and disease laden components of the mink ranch operation plant in Bhopal in the central Indian authorities are investigating, someone & the surrounding area.Once again the cages as their doomed relatives. In may also be targeted. state of Madhya Pradesh, killing on Sept. 21 tried to set a large crane rich of the world are destroying what their natural state, these animals In defense of life, ALF/ELF. thousands and contaminating water on fire at the construction site of the little we have left in terms of natural maintain a vast territory encompassing and soil within a one-mile (1.5-kilometer) Short Pump Town Center in western areas & collective holding (the wa- several miles. However, on fur farms December 3, Sweden: Rabbits radius. Over the years, the death toll Henrico County. The perpetrator lit a ter).” The difference between the ar- such as this one, most of these semi- Liberated From Horror Farm has risen to 14,410 as those sickened “wick” that had been placed in the sons at Sterling Woods & Pedigo Bay aquatic animals “enjoy” less than 24 Bruzaholm: The following communique by the gas died. Survivors complain of vehicle’s diesel fuel tank, but it went relates to graffiti sprayed on a build- inches of space, living on chicken wire, was received by the Swedish ALF Press ailments including breathlessness, out before starting a fire. The ers sign about 100 feet north of the exposed to incredible levels of disease, Office: On the night of December 3, constant tiredness, stomach pain, perpetrators didn’t leave a note or burnt house in Sterling Woods simply cannibalism, and weather extremes. the Swedish ALF attacked a small cardiac problems and tuberculosis. other evidence of responsibility. saying “No Sprawl - ELF.” With what is essentially still a wild rabbit farm in Bruzaholm, Sweden. Some 600,000 people have filed GGGGGGrrrrrreeeeeeeeeeeennnnnn AAAAAAnnnnnnaaaaaarrrrrrcccccchhhhhhyyyyyy ######111111111111 page 10