loading

Logout succeed

Logout succeed. See you again!

ebook img

Description of the snail-eating flatworm in marine aquaria, Pericelis tectivorum sp. nov. (Polycladida, Platyhelminthes) PDF

release year2019
file size9.6 MB
languageEnglish

Preview Description of the snail-eating flatworm in marine aquaria, Pericelis tectivorum sp. nov. (Polycladida, Platyhelminthes)

Zootaxa 4565 (3): 383–397 ISSN 1175-5326 (print edition) Article ZOOTAXA https://www.mapress.com/j/zt/ Copyright © 2019 Magnolia Press ISSN 1175-5334 (online edition) https://doi.org/10.11646/zootaxa.4565.3.5 http://zoobank.org/urn:lsid:zoobank.org:pub:003E948F-6747-450F-80AD-027BD629AFE2 Description of the snail-eating flatworm in marine aquaria, Pericelis tectivorum sp. nov. (Polycladida, Platyhelminthes) ISABEL L. DITTMANN1, WOLFGANG DIBIASI1, CAROLINA NOREÑA2 & BERNHARD EGGER1,3 1University of Innsbruck, Institute of Zoology, Technikerstr. 25, 6020 Innsbruck, Austria. E-mail: Isabel L Dittmann: [email protected]; Wolfgang Dibiasi: [email protected] 2Museo Nacional de Ciencias Naturales (CSIC), José Gutiérrez Abascal 2, 28006 Madrid, Spain. E-mail: [email protected] 3Corresponding author. E-mail: [email protected] Abstract We describe a new marine snail-eating flatworm, Pericelis tectivorum sp. nov., found in coral-bearing marine aquaria. Pericelis tectivorum sp. nov. is characterised by several differential characters of the external and internal morphology like 1) a long line of frontal eyes extending anteriorly; 2) the length of the penis papilla; 3) the spherical seminal vesicle; 4) the lack of the enlargements of the ejaculatory duct; 5) the uterine vesicles, which start posterior of the female genital at the level of the sucker and 6) the distinct sucker. The combination of these characters in one species is unique and there- fore the studied specimens are recognised by us as a new species. We additionally present a phylogenetic reconstruction using partial 28S rDNA sequences including three congeners. Our analysis demonstrates that P. tectivorum sp. nov. differs also genetically from other Pericelis species included in this analysis. Key words: Leopardenstrudelwurm (German), aquarium predator, integrative taxonomy, Cotylea, morphology Introduction The Polycladida is a large taxon of free-living flatworms, which is found almost exclusively in marine habitats. Most of these species are known from tropical seas (Newman & Cannon 1995, Bahia et al. 2017). Sometimes, these animals can also be found in marine aquaria, where they are often noted due to their preying behaviour, especially if their prey is of interest to humans (Rawlinson et al. 2011). Most polyclads prey on a variety of marine invertebrates, like molluscs, urochordates, crustaceans or cnidarians, whereas some polyclads show prey preference (Rawlinson et al. 2011). Worldwide about 1000 species have been scientifically described so far (Bahia et al. 2017), including four species of the genus Pericelis Laidlaw, 1902. Pericelis belongs to the suborder Cotylea (Lang 1884), although some features like a large encapsulated brain with well-defined globuli cell masses, a long, ruffled pharynx, the anteriorly directed uteri or the location of the copulatory complex in the posterior body quarter are more representative for the suborder Acotylea (Poulter 1974, Quiroga et al. 2015). Living Pericelis can be classified as cotyleans primarily because of their tiny marginal tentacles and their sucker posterior to the female genital opening (Poulter 1974). The dorsal marginal eyes, which can be found in a continuous series all around the body, characterise the genus Pericelis and many other polyclad genera, such as Aprostatum, Ilyplana, Nonatoma, or Parastylochus (Prudhoe 1985). Besides the type species P. byerleyana (Collingwood, 1876), three additional species are recognised, P. hymanae Poulter 1974, P. cata Marcus & Marcus, 1968 and P. orbicularis (Schmarda, 1859). In this study, we describe a new representative of this genus, Pericelis tectivorum sp. nov. Our description is based on live observations and pictures, serial histological sections and comparison of partial 28S rDNA sequences with other representatives of the genus Pericelis. Accepted by W. Sterrer: 29 Jan. 2019; published: 11 Mar. 2019 383 Material and methods Animals. The animals were obtained from a commercial coral-bearing marine aquarium shop in Innsbruck and a private coral-bearing marine aquarium in Landeck (Austria). Of eleven individuals in total, four animals were used; three specimens (numbered #5, #7 and #10; all from Innsbruck) for histological and molecular investigation, and another just for molecular investigations (#2; from Landeck). Only data of two sectioned animals are shown (#5, #10). All eleven collected individuals were used for live observations, and were kept in darkness in plastic boxes (ca. 15 x 20 cm) at room temperature. Feeding behaviour was observed by adding snails to the plastic boxes containing worms, and periodically checking if the food was accepted. Histology. Animals were fixed using the techniques described in Lee et al. (2006). Specimens were placed on filter paper, which was transferred on frozen fixative, dropping cold fixative on the animal's dorsal surface. The fixative solution was 3.5% formaldehyde (FA) in phosphate buffered saline (PBS). The copulatory region lies just posterior to the pharynx, hence for two specimens (#5, #7), we fixed only the posterior fourth of the body of sexually mature specimens, which was cut off the living animal with a razor blade. Only one specimen (#10) was used entirely. A soft brush was used for positioning and to ensure the specimens remained flat under the fixative (Lee et al. 2006). The specimens were left for at least twelve days in fixation solution at 4°C (fridge). Subsequently, the specimens were washed (PBS; aqua dest.), dehydrated in an ethanol series, cleared with intermedium (methyl benzoate over night; benzene 30 min), submerged in a 1:3 benzene:paraplast solution overnight and then embedded in paraplast. Specimens were serially sectioned at about 25–30 μm (#5) and at 10 μm (#7, #10) and stained with Azan trichromic stain after Romeis (1989). Documentation. Live animals (#2, #5, #7) were photographed with a Canon EOS 5D Mark II camera equipped with a Canon Lens EF 100 mm 2.8L Macro IS USM objective and a Canon Macro Twin Lite MT-26EX- RT flash. Sections were documented with a Leica DM 5000B compound microscope equipped with a Leica DFC 490 digital camera for photographing. Further image processing was performed with Adobe Photoshop CS2 and 7. Drawings were produced in Adobe Illustrator CS2 and CS6. DNA extraction, PCR amplification and sequencing. DNA was extracted from a small piece of marginal tissue and stored in absolute ethanol. DNA extraction was performed following a phenol-chloroform protocol (Chen et al. 2010). Concentration and quality of extracted DNA was checked by NanoDrop (NanoDrop Fluorospectrometer Thermo Fisher Scientific, USA). Partial 28S rDNA markers were amplified using published 28S primers (see Table 1 for primer sequences and references). Polymerase chain reaction (PCR) was performed using Taq DNA polymerase (New England BioLabs, USA), 1 μl of forward and reverse primers and between 8.6 ng and 107 ng of DNA template. #2, #7 and #10 were amplified with a standard PCR protocol, while for #5 a touchdown protocol was employed. The standard PCR protocol was: 5 min of initial denaturation at 94°C; and then 35 cycles of: 30 s of denaturation at 94°C; annealing at 53°C for 30 s; extension at 72°C for 2 min. Final extension at 72°C for 10 min. The touchdown PCR conditions were: 5 min of initial denaturation at 94°C; 12 cycles of 30 s of denaturation at 94°C; annealing at 68–45°C for 30 s; extension at 72°C for 2 min. 23 cycles of 30 s of denaturation at 94°C; annealing at 45°C for 30 s; extension at 72°C for 2 min. Final extension at 72°C for 10 min. Successful amplicons were purified with the Wizard® SV gel and PCR clean-up system (Promega, USA) according to the manufacturer’s quick protocol. The purified PCR products were sequenced by Microsynth Austria GmbH, using premixed primers listed in Table 1. Sequences were assembled and edited using the software CLC Main Workbench 7 (https://www.qiagenbioinformatics.com/). TABLE 1. Primers. 28S_LSU5_fw TAGGTCGACCCGCTGAAYTTAAGCA Larsson et al. 2008 Specimens: #2; #5; #7; #10 L1642R CCAGCGCCATCCATTTTCA Larsson et al. 2008 #2; #7 28S_6R GGAACCCTTCTCCACTTCAGT Charbagi-Barbirou et al. 2011 #5; #10 Dataset for phylogenetic analyses. Additional partial 28S sequences were downloaded from NCBI (Pericelis orbicularis EU679116.1; Pericelis cata EU679115.1; Pericelis cata EU679114.1; Pericelis byerleyana MH047291.1. As outgroup, Theama sp. KC869845.1 was selected and downloaded. Accession numbers of the newly generated sequences of Pericelis tectivorum sp. nov. are MK181524 (#2, Landeck), MK181525 (#5, Innsbruck), MK181526 (#7, Innsbruck) and MK181527 (#10, Innsbruck). The dataset was aligned using the MAFFT Q-INS-i algorithm (Katoh & Standley 2013) and sequences were manually trimmed to a length of 941 nucleotides. Phylogenetic reconstruction using Bayesian inference was done with MrBayes 3.2.6 (Ronquist et al. 2012) with the settings 'lset nst=6 rates=invgamma' (as suggested by jModelTest 2.1.10, Posada 2008) for 10 384 · Zootaxa 4565 (3) © 2019 Magnolia Press DITTMANN ET AL. million generations (samplefreq=100, diagnfreq=1000). Standard deviation of split frequencies was well below 0.001, and the first 25% of trees were discarded as burn-in. Results Rhabditophora Ehlers, 1985 Order Polycladida Lang, 1881 Suborder Cotylea Lang, 1884 Superfamily Periceloidea Laidlaw, 1902 Family Pericelidae Laidlaw, 1902 Genus Pericelis Laidlaw, 1902 Pericelis tectivorum sp. nov. (Figs. 1–6) Material examined. Pericelis tectivorum sp. nov. specimens #5; #10, sagittally sectioned. Type material. Sagittal serial sections of the holotype (NHMW_EvMicro 5771/1-45) and paratype (NHMW EvMicro 5772/1-250), and marginal tissue sample in 100% ethanol of the paratype (NHMW EvWet 21221) submitted to the Natural History Museum Vienna, Austria). Holotype. One sagittally sectioned specimen (#5) stained with Azan. Paratype. One sagittally sectioned specimen (#10) stained with Azan. Type locality. Commercial seawater aquarium 'Alpenriff' in Innsbruck (Tirol; Austria). Other material observed. Live observations of four live specimens from Landeck (including specimen #2), seven from Innsbruck (including specimens #5, #7 and #10). Partial 28S sequences of one specimen from Landeck (#2) and three specimens from Innsbruck (#5, #7, #10). Histological remarks. One sample, #7, was found to be not fixed well and the tissue appeared broken and disjointed in the sections. Therefore, it was not used for further analyses. The Azan trichrome staining looks markedly different in colour and intensity between holotype (#5) and paratype (#10), although the same recipe was used. The thickness of the sections (25–30 µm in #5 and 10 µm in #10) and the age of the prepared solutions may have influenced the appearance. Etymology. After the observed prey of the species, Tectus fenestratus (Gmelin, 1791), a snail of the family Tegulidae and after the Latin word 'vorare' which means 'devour' in English. Synonym. In German, this or a related species are referred to as the 'Leopardenstrudelwurm' (the 'leopard turbellarian'). Appearance. Elongated oval body, holotype 7 cm long and 4 cm wide (paratype: 5 cm long and 3 cm wide). The pharynx length is about 50% of the body length. Two thin marginal tentacles at anterior body edge (Fig 1A, B). Margin slightly ruffled. Cerebral eyes clusters posterior to a well-marked V-shaped notch between the tentacles, well separated, elongated, oval in form, directly merging to a line of frontal eyes extending in a fan-like shape towards the tentacles. From anterior to posterior, the line of frontal eyes is about the same length as the cerebral eye cluster (Fig. 2). Tentacle eyes are especially dense at the tips (Figs. 1B, 2). Dorsal colouration with white spots on dark brown background, highest density of spots along the margins, darkest in colour along the median line (Fig. 1A). Ventral colouration: whitish, nearly bluish grey, dendritic markings in the shade of pearl white (Fig. 1D). Genital pores in the posterior third. Male and female genital pores very close (ca. 50 µm apart) to each other, but no common gonopore. Sucker lies just posterior to the female gonopore (Figs. 1E, 3A, 4B). Reproductive system. In both, the holotype and the paratype, the male and female copulatory organs are well developed (Fig. 3). Male copulatory complex shows a spherical seminal vesicle (Fig. 5E–K); two paired, heavily muscularised spermiducal bulbs (Fig. 5A–B, T–W), laterally orientated. Without prostatic vesicle or prostatic glands; ejaculatory duct narrow and long. Penis papilla cylindrical (0.5–0.6 mm long), U-shaped (holotype, Figs. THE SNAIL-EATING FLATWORM PERICELIS TECTIVORUM SP. NOV. Zootaxa 4565 (3) © 2019 Magnolia Press · 385 5G–P, 6A) or pointing ventro-posteriorly (paratype, Fig. 4A, C). Tapered in the last distal section. The whole penis papilla projects into the male atrium.Female genital complex with about six uterine vesicles per side, starting posteriorly at the level of the sucker and proceeding anteriorly (Figs. 3A, 4B). Female atrium or vagina externa of P. tectivorum sp. nov. runs upwards from the female gonopore and expands at the level of the cement pouch (Figs. 3B, 4A). Vagina interna narrows afterwards, turns downwards and opens into the oviduct. FIGURE 1. Live images of P. tectivorum sp. nov. A. Dorsal view. B. Detailed view of the tentacles. C. Detailed view of the cerebral and anteriorly extending frontal eyes. D. Dorsal view. E. Detailed view of the sucker. br = brain; ce = cerebral eyes; fe = anteriorly extending frontal eyes; su = sucker; t = tentacle. Orientation: anterior directed upwards. 386 · Zootaxa 4565 (3) © 2019 Magnolia Press DITTMANN ET AL. FIGURE 2. Drawing of the eye configuration of P. tectivorum sp. nov. ce = cerebral eyes; fe = frontal eyes; me = marginal eyes; te = tentacle eyes. Orientation: anterior to the left. Lab cultures and feeding. Pericelis tectivorum sp. nov. was observed to prey on Tectus fenestratus mainly at night. During daytime, worms were hidden under stones or other objects in the commercial aquarium (pers. com. Christian Hepperger). In lab cultures, the worms were observed to slide over the snail shell and stay in this position for several minutes. In some cases, the snail started strongly to turn back and forth. However, we were not able to recognise if this was active movement of the snail or if it was moved by P. tectivorum sp. nov. The feeding act could not be observed, but devoured snails were recognised by the presence of empty snail shells and associated opercula. Both the snail shell and the operculum were intact and not damaged by the worm. Dark food particles were clearly noticeable in the gut of Pericelis. Molecular analyses based on partial 28S rDNA sequences. In our phylogenetic reconstruction of four different species of the genus Pericelis (Fig. 7), the specimens of P. tectivorum sp. nov. are recovered with maximal support as sister group of P. byerleyana, and these two are sister group of P. orbicularis. P. cata is sister group of all other available Pericelis species. THE SNAIL-EATING FLATWORM PERICELIS TECTIVORUM SP. NOV. Zootaxa 4565 (3) © 2019 Magnolia Press · 387 FIGURE 3. Sagittal sections of male and female genitals, as well as of the sucker of P. tectivorum sp. nov. (holotype). A. Female genitals and sucker. B. Penis papilla and female genitals. C. Spherical seminal vesicle and penis papilla. cg = cement glands; cp = cement pouch, ed = ejaculatory duct; fa = female atrium; ma = male atrium; p = pharynx; pp = penis papilla; sbe = spermiducal bulb entrance; su = sucker; sv = seminal vesicle; uv = uterine vesicle; v = vagina. Orientation: anterior to the left. Scale 200 µm. Sequence identity was found to be 100% between all sequences of Pericelis tectivorum sp. nov. (one specimen from Landeck, three from Innsbruck) in the 941-nucleotide partial 28S alignment. Between P. tectivorum sp. nov. and P. byerleyana, 99.35% identity (6 nucleotides difference), and between P. tectivorum sp. nov. and P. orbicularis, 98.18% identity (17 nucleotides difference) was observed. In a longer alignment with a length of 1362 nucleotides of only P. tectivorum sp. nov. sequences, three sequences from Landeck and Innsbruck were 100% identical (#2, #5, #10), while #7 was in two nucleotide positions (99.85% identity). 388 · Zootaxa 4565 (3) © 2019 Magnolia Press DITTMANN ET AL. FIGURE 4. Sagittal sections of male and female genitals, as well as of the sucker of P. tectivorum sp. nov. (paratype). A. Penis papilla and female genitals. B. Female genitals and sucker. C. Spherical seminal vesicle and penis papilla. cg = cement glands; cp = cement pouch, ed = ejaculatory duct; fa = female atrium; ma = male atrium; p = pharynx; pp = penis papilla; su = sucker; sv = seminal vesicle; uv = uterine vesicle; v = vagina. Orientation: anterior to the left. Scale 200 µm. Discussion The family Pericelidae is riddled by a variety of divergent descriptions (see Table 2) of Pericelis byerleyana (Collingwood, 1876), the type of the genus (Laidlaw 1902). Descriptions by Collingwood (1876), Laidlaw (1902), Meixner (1907), Kato (1943) or Velasquez et al. (2018) about morphology and anatomy of different specimens of the nominally same Pericelis species vary widely (see Table 2) and make the determination more difficult. Additionally, some Pericelis species resemble each other in some points of the external morphology, like colour and eye patterns. In total, four species of the genus Pericelis have been described so far: P. orbicularis (Schmarda, 1859), P. byerleyana (Collingwood, 1876), P. cata Marcus & Marcus, 1968, and P. hymanae Poulter, 1974. Therefore, it is important to compare all morphological characters of the new species, P. tectivorum sp. nov., with the four other well-known species (Table 2) and distinguish between the available molecular sequences. THE SNAIL-EATING FLATWORM PERICELIS TECTIVORUM SP. NOV. Zootaxa 4565 (3) © 2019 Magnolia Press · 389 FIGURE 5. Sagittal serial sections of the male genital of P. tectivorum sp. nov. (holotype). A–D. First spermiducal bulbs with entrance. E. Junction between spermiducal bulbs to seminal vesicle. F–J. Seminal vesicle. K–N. Penis papilla. O–R. Male atrium. S–W. Second spermiducal bulbs with entrance. ed = ejaculatory duct; ma = male atrium; mg = male gonopore; pp = penis papilla; sb = spermiducal bulbs; sbm = sperm bulb muscles; sbe = spermiducal bulbs entrance; sv = seminal vesicle. Orientation: anterior to the left. Scale A-V 200 µm, W 50 µm. External morphology. Colour and pattern. The colouration of P. tectivorum sp. nov., which consists of white spots on dark brown background, is almost identical to the colouration of P. byerleyana, which is described as 390 · Zootaxa 4565 (3) © 2019 Magnolia Press DITTMANN ET AL. “beautifully marbled, with light brown rings” by Collingwood (1876). However, except for P. hymanae, which is coloured off-white (Poulter 1974), all species of the genus Pericelis resemble each other in the combination of colour pattern, cream or beige with a reticulated brown pattern. But even if the combination of colour pattern is similar, they are not identical. The dorsal side of P. cata shows a dark pattern interrupted by round white areas, which sometimes coalesce to larger blotches. Some of the dark patches contain scattered black spots (Marcus & Marcus 1968). Pericelis orbicularis is coloured by a reddish brown, fine-lined network on a paler ground (Schmarda 1859; Hyman 1955; Marcus & Marcus 1968). However, the colouration, which often differs intra- specifically, is not sufficient for species identification, but gives us a first indication that the new species belongs neither to P. hymanae, nor to P. cata. Only looking at the colouration, the distinction between P. tectivorum sp. nov., P. byerleyana and P. orbicularis is problematic. FIGURE 6. Comparison of the genitals of P. tectivorum sp. nov. and P. byerleyana. A. Reconstruction of the genital of P. tectivorum sp. nov. B. Reconstruction of the genital of P. byerleyana after Meixner 1907. cg = cement glands; cp = cement pouch ed = ejaculatory duct; fa = female atrium; ma = male atrium; p = pharynx; pp = penis papilla; sb = spermiducal bulbs; sbe = spermiducal bulbs entrance; su = sucker; sv = seminal vesicle; uv = uterine vesicle; ute = uterine entrance; v = vagina; vd = vasa deferentia; vde = vasa deferentia entrance. Orientation: anterior to the left. THE SNAIL-EATING FLATWORM PERICELIS TECTIVORUM SP. NOV. Zootaxa 4565 (3) © 2019 Magnolia Press · 391 Eye spot cluster. Another informative character is the configuration and form of eye spot clusters, in particular those of cerebral and frontal eyes. A clear delimitation of cerebral and frontal eyes is often difficult. The two clusters of cerebral eyes of P. tectivorum sp. nov. are separated, elongated, oval-shaped and directly merging to a line of frontal eyes extending in a fan-like shape anteriorly (Fig. 2). This configuration resembles the description of the cerebral eye cluster of P. byerleyana (Laidlaw 1902; Meixner 1907), however, the line of frontal eyes (excluding the more anterior fan-shaped part) in P. tectivorum sp. nov. is about double in length than in P. byerleyana (Fig. 8A, B) compared to the length of the cerebral eye cluster. The cerebral eyes of P. hymanae are described and drawn as paired elongated oval groups located behind the anterior margin, with frontal eyes fanning out towards the tentacles and few frontal eyes in the region of the midline (Poulter 1974). The description of the cerebral eye clusters of P. hymanae is distinctly different from the eye clusters in P. tectivorum sp. nov. (Fig. 8A, F). Like P. hymanae, the cerebral eye cluster of P. cata forms an elongated oval cluster (e.g. Marcus & Marcus 1968, Bahia & Padula 2009, Queiroz et al. 2013) different, therefore, from P. tectivorum sp. nov. (Fig. 8A, C). The cerebral eyes of P. orbicularis are described in different ways. Schmarda (1859) and Stummer-Traunfels (1933) draw the cerebral eyes as two well separated stripes forming a wedge (Schmarda 1859; Stummer-Traunfels 1933) (Fig. 8E). On the other hand, Hyman (1955) describes “a group of eyes, scarcely paired, overlies the brain region and from these cerebral eyes cerebro-frontal eyes spread to the anterior margin in a fanlike manner”. In contrast, and similar to Schmarda (1859) and Stummer-Traunfels (1933), Marcus & Marcus (1968) describe the cerebral eye clusters as two broad stripes running close to each other, not as a loose cluster as drawn by Hyman (1955) (Marcus & Marcus 1968) (Fig. 8D). The description of Marcus & Marcus (1968) for P. orbicularis is less clear, as no related figure is available. We cannot clarify this controversy, but we may say that neither of these descriptions of the eye cluster of P. orbicularis resemble the eye clusters of P. tectivorum sp. nov. (Fig. 8A, D, E). In conclusion, the eye spot cluster of P. tectivorum sp. nov. is closest to P. byerleyana, but differs from all descriptions of the genus Pericelis. Size. The largest specimen of P. tectivorum sp. nov. was up to 7 cm long and up to 4 cm wide, while P. byerleyana was found with a body length of up to 6 cm (Kato 1943), but most often with a significantly shorter body of 1.8 to 3.5 cm (see Table 2). The largest animal found of P. hymanae has a reported length of about 4.8 cm (Poulter 1974), and that of P. cata of about 6 cm (Marcus & Marcus 1968). The smallest species described is P. orbicularis with a length of up to 2.5 cm (Marcus & Marcus 1968). Pharynx. In P. tectivorum sp. nov. the pharynx length as a percentage of body length is about 50%, similar to all other described Pericelis species except P. orbicularis, where the relative pharynx length is noticeably smaller (see Table 2). Internal morphology. For species determination of polyclads, the internal morphology is often decisive. The most informative character for identification of flatworm species in general and indeed for animals belonging to the genus of Pericelis are the copulatory organs (Marcus & Marcus 1968). Male copulatory complex. The penis papilla of the holotype of P. tectivorum sp. nov. is strongly bent in a U- shape (Figs. 5, 6), whereas the penis papilla of the paratype is straight (Fig. 4). The description of P. byerleyana by Laidlaw (1902) defines the penis as muscular, directed backwards, conical in shape and tapering to a fine point, which projects into a long and extremely narrow male atrium. Meixner (1907) describes the penis of P. byerleyana as long, cylindrical in form, just tapering before the distal end and located parallel to the ventral side of the body (Fig. 6B). These inconsistencies in the descriptions of the shape and bending of the male genitals within the same species are likely to result from their position at the moment of fixation. The bending of the penis papilla might therefore be a rather weak character for species determination. However, the length of the penis papilla of P. tectivorum sp. nov. measures between 0.5 and 0.6 mm, whereas the penis papilla of P. byerleyana is 1.1 mm long (Meixner 1907) even though the overall body length of P. tectivorum sp. nov. is twice as large as P. byerleyana. The bending of the penis papilla is absent in P. hymanae, P. cata and P. orbicularis, and their respective lengths are 0.7 mm, 0.5 mm and unknown (see Table 2). Also interesting to note is the very prominent, spherical seminal vesicle of P. tectivorum sp. nov. All species of Pericelis, except P. byerleyana, have a very prominent seminal vesicle. Meixner (1907) characterises the seminal vesicle of P. byerleyana as not very prominent. He assumes that an extremely muscular, elongated section of the ejaculatory duct without enlargement of the lumen is able to function as seminal vesicle (Meixner 1907). The seminal vesicle of P. tectivorum sp. nov. is in contrast strongly enlarged and spherical in form, similar to P. hymanae, P. cata and P. orbicularis. 392 · Zootaxa 4565 (3) © 2019 Magnolia Press DITTMANN ET AL.

See more

The list of books you might like