Logout succeed
Logout succeed. See you again!

Characteristics and Structural Requirements of Apical Sorting of the Rat Growth Hormone through ... PDF
Preview Characteristics and Structural Requirements of Apical Sorting of the Rat Growth Hormone through ...
JBC Papers in Press. Published on September 27, 2001 as Manuscript M108187200 Characteristics and Structural Requirements of Apical Sorting of the Rat 1 Growth Hormone through the O-glycosylated Stalk Region of Intestinal 2 Sucrase-Isomaltase 3 4 Nikolaj Spodsberg, Marwan Alfalah, and Hassan Y. Naim 5 6 7 8 9 10 Correspondence should be addressed to: 11 Hassan Y. Naim, Ph.D. D o w n 12 Department of Physiological Chemistry lo a d e d 13 School of Veterinary Medicine Hannover fro m h 14 Bünteweg 17 ttp ://w 15 D-30559 Hannover, Germany ww .jb c 16 Tel.: 49 511 9538780 .o rg b/ 17 Fax: 49 511 9538585 y g u e s 18 E-mail: [email protected] t on A p 19 ril 3 , 2 0 20 Abbreviations: SI, sucrase isomaltase; GH, growth hormone; TGN, trans-Golgi network; Ab, 19 21 antibody; PAGE, polyacrylamide gel electrophoresis; Benzyl-GalNAc, benzyl-N-acetyl-?-D- 22 galactosaminide; Endo H, endoglycosidase H; Endo F, endoglycosidase F; DMEM, Dulbecco’s 23 modified Eagle’s medium; MDCK, Madin-Darby canine kidney cells; TM, transmembrane; SR, 24 stalk region; TX-100, Triton X-100 25 26 Running title: Sorting of SI stalk region 27 28 29 1 Copyright 2001 by The American Society for Biochemistry and Molecular Biology, Inc. 1 2 3 4 5 ABSTRACT 6 The apical sorting of the small intestinal membrane glycoprotein sucrase-isomaltase (SI) depends on 7 the presence of O-linked glycans and the transmembrane domain. Here, we investigate the role of 8 O-glycans carried by the Ser/Thr-rich stalk region of SI as an apical sorting signal and evaluate the 9 spatial requirements for an efficient recognition of this signal. Several hybrid proteins are generated 10 comprising the unsorted and unglycosylated protein, the rat growth hormone (rGH), fused to either 11 the transmembrane domain of SI (GH-SITM), or the transmembrane and the stalk domains (GH- Dow n lo a 12 SISR/TM). Both constructs are randomly distributed over the apical and basolateral membranes of ded fro m 13 MDCK cells indicating that neither the transmembrane domain nor the O-glycans are sufficient per http ://w w 14 se for an apical delivery. Only when a polyglycine spacer is inserted between the stalk region of SI w.jb c .o rg 15 and the luminal part of rGH in the GH-SIGly/SR/TM fusion protein does efficient apical sorting of an O- by/ g u e s 16 glycosylated protein as well as a time-dependent association with detergent-insoluble lipid t o n A p 17 microdomains occur. Obviously, the polyglycine spacer facilitates the accessibility of the O-glycans ril 3 , 2 0 1 9 18 in GH-SI to a putative sorting receptor, while these glycans are inadequately recognized in Gly/SR/TM 19 GH-SI . We conclude that the O-glycans in the stalk region of SI act as an apical sorting signal SR/TM 20 within a sorting machinery that comprises at least a carbohydrate-binding protein and requires 21 specific spatial requirements provided, for example by a polyglycine spacer in the context of rGH or 22 the P-domain within the SI enzyme complex. 23 24 25 2 1 2 D o w n lo a d e d fro m h ttp ://w w w .jb c .o rg b/ y g u e s t o n A p ril 3 , 2 0 1 9 3 1 INTRODUCTION 2 3 The polarity of epithelial cells is characterized by two functionally and structurally different plasma 4 membrane domains, the apical and the basolateral. Separated by tight junctions, the two surfaces 5 contain distinct compositions of proteins and lipids. The maintenance of polarity requires sorting as 6 well as domain specific retention of newly synthesized and recycling proteins (1,2). Protein 7 constituents are transported along the secretory pathway to the trans Golgi network (TGN) where 8 they are sorted to either one of these two domains (3-5). Basolateral targeting generally depends 9 upon the existence of a tyrosine-based cryptic signal or a di-leucine motif in the cytoplasmic tail of D o w n lo 10 the sorted protein (1,6). The apical delivery of membrane and secretory proteins is more complex ad e d fro m 11 and utilizes several types of signals suggesting the exitence of multiple binding sites for apical signals h ttp ://w 12 in the sorting machinery. Glycolipid anchors direct proteins to the apical surface of several types of w w .jb c .o 13 epithelial cells (7), apparently by associating in the TGN with detergent-insoluble membrane domains rg b/ y g u 14 enriched in glycosphingolipids and cholesterol (8,9). The transmembrane segments of influenza virus est o n A p 15 neuraminidase (NA) (10,11) and hemagglutinin (HA) specify apical transport, and in the case of HA, ril 3 , 2 0 1 16 several residues critical for this function have been identified (12). N-linked oligosaccharides on 9 17 some secreted proteins appear to specify apical transport (13), although this mechanism does not 18 apply to all secreted proteins (14,15) and has not been conclusively demonstrated for membrane 19 bound proteins (16,17). O-glycosylation is also critically important in the sorting event of some 20 membrane glycoproteins (18). Specific inhibition of O-glycosylation of intestinal sucrase-isomaltase 21 with benzyl-GalNAc (benzyl-N-acetyl-?-D-galactosaminide) as well as deletion of the potentially 22 O-glycosylated Ser/Thr-rich stalk domain abolished the high fidelity of apical sorting of SI and 23 resulted in a random transport of the protein to both membranes (19,20). Likewise, a dominantly O- 4 1 glycosylated domain juxtapose the membrane of the neurotrophin receptor is presumably implicated 2 in its apical sorting (14,21). 3 It is not obvious, however, from these observations whether O-glycans constitute the sorting signal 4 per se, or they do impose a particular folding determinant in the context of the actual sorting signal. 5 Analysis of various deletion mutants of SI demonstrated that O-glycosylation and membrane 6 anchoring of SI are required for the association of the enzyme with cholesterol and 7 glycosphingolipid-rich lipid microdomains and subsequent apical sorting. Moreover, a possible role 8 for an O-glycosylated Ser/Thr-rich stalk domain that immediately follows the membrane domain and 9 belongs to the isomaltase subunit in the sorting of SI has emerged. However, SI comprises two D o w n lo 10 strongly homologous subunits that are both O-glycosylated and a possible contribution of O-glycans ad e d fro m 11 in the sucrase subunit to the structure of a putative sorting signal can not be excluded. The basic aim h ttp ://w 12 of this paper is to assess the requirements needed for an efficient sorting of apical proteins using the w w .jb c .o 13 high polarized protein sucrase-isomaltase as a model. In particular, the role of O-glycans located in rg b/ y g u 14 the stalk region of SI and the spatial constraints that influence an efficient recognition of these est o n A p 15 structures through putative sorting elements have been investigated. Using chimeras of the a non- ril 3 , 2 0 1 16 polarized protein model, the rat GH, fused to the stalk transmembrane domains of SI we could show 9 17 that O-glycosylation is absolutely required for apical sorting. However, specific spatial requirements 18 should be fullfilled for an efficient recognition of these glycans by a putative carbohydrate-binding 19 protein. 20 21 5 1 MATERIALS AND METHODS 2 Materials – Restriction enzymes, Taq DNA polymerase, ligase, Endo-ß-N-acetylglucosaminidase H 3 (endo H), endo-ß-N-acetylglucosaminidase F (containing N-glycosidase F) (endo F/GF) and 4 phenylmethanesulfonyl fluoride were purchased from Roche Biochemicals (Mannheim, FRG). 5 Streptomycin, penicillin, Dulbecco’s modified Eagle’s medium (DMEM), minimum essential medium, 6 methionine-free DMEM, and foetal calf serum were purchased from Gibco Life Technologies 7 (Eggenstein, FRG). L-(35S) RedivueTM PRO-MIXTM (> 800 Ci/ mmol) and protein A-Sepharose 8 was purchased from Amersham/Pharmacia Biotech (Freiburg, FRG). Acrylamide, ammonium 9 persulfate, dithiothreitol, 2-mercaptoethanol, N,N‘-methylenebisacrylamide, SDS, TEMED, and D o w n lo 10 Triton X-100 were acquired from Carl Roth GmbH & Co (Karlsruhe, FRG). DEAE-dextran, ad e d fro m 11 benzamidine, aprotinin, leupeptin, pepstatin, molecular weight standards for SDS-Page and trypsin h ttp ://w 12 were purchased from Sigma (Deisenhofen, FRG). Polyclonal anti-mouse GH antibody, which cross- w w .jb c .o 13 reacts with rat GH, was a generous gift of Dr. Sinha (22). rg b/ y g u 14 Expression of Chimeras of the Rat Growth Hormone Fused to Various Domains of SI in est o n A p 15 MDCK Cells – Hydrophilic rat GH is an unglycosylated polypeptide that is randomly secreted in ril 3 , 2 0 1 16 polarized MDCK cells from the apical as well as basolateral membranes (13). It could be therefore 9 17 conveniently used as a reporter gene to analyze the role of specific putative sorting signals. Previous 18 studies on a possible role of N-glycosylation in apical sorting have utilized mutants of this protein 19 which contained potential N-glycosylation sites (13). As such the trafficking randomness of the 20 protein could be abolished and polarized secretion of the protein through the apical membrane has 21 occurred. Obviously N-glycans are implicated in the sorting event either directly being the sorting 22 signal itself or indirectly by generating particular structural determinants in rat GH that constitute the 23 sorting signal. Previous data from our own work have provided ample evidence for a strong 24 implication of O-glycans in the sorting of intestinal sucrase-isomaltase (18-20). To examine the role 6 1 of O-glycosylation in the apical sorting event by making chimeras comprising unglycosylated rat GH 2 as a reporter gene and the Ser/Thr rich stalk domain and the transmembrane domain of human 3 sucrase-isomaltase. In the wild type SI protein the Ser/Thr-stalk domain is heavily O-glycosylated 4 and the transmembrane domain is required for SI to enter into cholesterol/sphingolipid-rich 5 membrane microdomains (19). Using wild type rat GH in these chimeras rather than a mutagenized 6 form of rat GH in which potential N- or O-glycosylation sites are introduced should provide a direct 7 evidence regarding the location of the apical sorting signal in the stalk region. This is because no 8 alteration in the structural features of rat GH per se would be expected and therefore any influence 9 on the trafficking behavior of this reporter gene would be directly related to the introduced domain. D o w n lo 10 We first generated two chimeras. In the first one the cleavable signal sequence of the type I protein ad e d fro m 11 rat GH was eliminated and replaced by the N-terminal transmembrane domain (TM) of the type II h ttp ://w 12 protein SI which contains an uncleavable signal sequence (23). The generated construct comprised w w .jb c .o 13 the sequences Met1 -Ala32 of SI and Leu27-Phe216 of rat GH and is denoted GH-SI (Fig. 1). The rg TM b/ y g u 14 second construct was designed to directly assess the role of the stalk domain of SI in sorting and est o n A p 15 comprised the transmembrane domain and the stalk region of SI (Met1 – Ser60) fused to the Leu27- ril 3 , 2 0 1 16 Phe216 sequences of rat GH (denoted GH-SI ) (Fig. 1). These constructs were expressed in 9 SR/TM 17 MDCK cells and their transport kinetics and sorting were analyzed. We excluded wild type rat GH 18 from these studies since biosynthesis and trafficking of this protein is well established (24,25) and will 19 be only referred to where appropriate. The expression constructs were generated as follows. The 20 cDNA of rat GH lacking its own signal sequence and encoding amino acid residues 27-190 was 21 fused to the cDNA coding for the cytoplasmic tail (amino acid residues 1-12) and the membrane 22 anchoring domain of the type II protein human SI (amino acid residues 13-32) which contains the 23 signal sequence for ER translocation. The construct was generated by PCR using the plasmids 24 pSG8-hSI (26) and pSVGH (24) as templates and the following oligonucleotides: 7 1 SI 5‘HindIII: 5‘GGAAGCTTGCTATGAAATAAGATGG 3‘; 2 crGH: 5‘ GGGCGGCCGCTAGAAAGCACAGCTGCTTTC 3‘; 3 SItmGH: 5‘GTTGTTTTAGCATTACCTGCCATGCCCTTGTCCA 3‘; 4 cSItmGH: 5‘ CATGGCAGGTAATGCTAAAACAACAATTAAGGCA 3‘. 5 The resulting product was cloned as a Hind III-Not I fragment into pCDNA3 (Invitrogen, 6 Groningen, The Netherlands) to generate pCDNA3-GHSI . Similarly, the pCDNA3-GHSI TM SR/TM 7 encoding the SI cytoplasmic tail, transmembrane region and stalk region of SI (AA 1 – 60) fused to 8 rat growth hormone without the signal sequence (AA 27 – 190) was generated using the 9 oligonucleotides: D o w n lo 10 SI5‘HindIII: 5‘AAGCTTGCTATGAAATAAGATGG 3‘; ad e d fro m 11 cSIstalkGH: 5' CATGGCAGGTAATGAATCAGAAGGATTTGTAGTC 3'; h ttp ://w 12 SIstalkGH: 5' CCTTCTGATTCATTACCTGCCATGCCCTTGTCCA 3'; w w .jb c .o 13 and crGH3'NotI: 5' GGGCGGCCGCTAGAAAGCACAGCTGCTTTC 3'. rg b/ y g u 14 For generation of the plasmid pCDNA3-GHSIGly/SR/TM encoding eight consecutive glycines inserted est o n A p 15 between the stalk domain of SI and the rat GH, an Acc III site was introduced into pCDNA3- ril 3 , 2 0 1 16 GHSI by site-directed mutagenesis according to the QuickChange protocol (Stratagene, 9 SR/TM 17 Amsterdam, The Netherlands) using the oligonucleotides 18 ACCIII 5‘ CAAATCCTTCTGATTCCGGACCTGCCATGCCCTTG 3‘ 19 and cACCIII 5‘ CAAGGGCATGGCAGGTCCGGAATCAGAAGGATTTG 3‘. In addition to the 20 introduction of the Acc III restriction site, this mutation resulted in an amino acid substitution of 21 leucine by a glycine at amino acid residue 27 of rat GH. The resulting plasmid was opened with Acc 22 III and dephosphorylated, and a doublestrand linker of 23 8Gly 5‘ CCGGAGGTGGCGGGGGAGGCGGAGGCG 3‘ 8 1 and c8Gly 5‘ CCGGCGCCTCCGCCTCCCCCGCCACCT 3‘ containing 5‘ phosphates were 2 ligated into the plasmid. The inserted sequence encodes eight glycines and an alanine located 3 between the final serine belonging to the stalk region of SI at residue 60 and the first glycine of rat 4 GH at amino acid residue 27. All the hybrid cDNA sequences were verified complete sequencing. 5 Cell Culture and Transfection – Madin-Darby Canine Kidney (MDCK) cells (strain II) were 6 maintained subconfluent in Dulbecco’s modified Eagle’s medium (DMEM), (Gibco Life 7 Technologies, Eggenstein, FRG) supplemented with 10% fetal bovine serum, penicillin (100 u/ml) 8 and streptomycin (100 µg/ml) at 37 °C in a humidified 5% CO incubator. Transfections were 2 9 performed using calcium phosphate-DNA precipitation procedure (27). To establish stably D o w n lo 10 expressing cell-lines, cells were selected with 0.4 mg/ml G418 (Gibco Life Technologies, Eggenstein, ad e d fro m 11 FRG) for two weeks after which individual clones were isolated and screened for expression of the h ttp ://w 12 chimeric protein with a polyclonal monkey anti-mouse GH antibody which cross-reacts with rat GH w w .jb c .o 13 (22). For analysis of cell-surface polarity, cells were grown on Transwell filters (24 mm, 0.4 µm) rg b/ y g u 14 (Becton Dickinson GmbH, Heidelberg, FRG) for one week after confluence. For all other est o n A p 15 experiments cells were grown in 100 mm culture dishes (Greiner GmbH, Frickenhuasen, FRG). ril 3 , 2 0 1 16 Biosynthetic labeling of cells, immunoprecipitation and SDS-PAGE – Stably transfected 9 17 MDCK cells were biosynthetically labeled with 80µCi L-(35S) RedivueTM PRO-MIXTM 18 (Amersham/Pharmacia, Freiburg, Germany) as described by Naim et al. (28) either continuously or 19 by employing a pulse-chase protocol. Here, cells were pulse labeled for 30 min and chased for 20 different periods of time with cold methionine. The cells were solubilized for 20 min. at 4 °C with a 21 Nonifet P-40 lysis buffer (1% NP-40, 0.1 % SDS, 50 mM Tris-HCl, pH 8.0) containing a mixture 22 of protease inhibitors 1 µg/ml/ml aprotinin, 17.4 µg/ml benzamidine, 5 µg/ml leupeptin, 1 µg/ml 23 pepstatin. The cell lysates and the media after the biosynthetic labeling were immunoprecipitated with 24 the polyclonal monkey anti-mouse GH antibody used at 1:1000 concentration and the antigen- 9 1 antibody complex was captured by protein A-Sepharose essentially as described by Naim et al. 2 (28). The immunobeads were washed according to the procedure described by Thomas et al. (29). 3 Cell surface immunoisolation of rat GH from MDCK cells expressing rat GH and grown on filters 4 was performed essentially as described by Jacob et al. for intestinal lactase-phlorizin hydrolase (30). 5 Here, MDCK cells were labeled for 4 h with 100 µCi [35S]methionine. The protein chimeras were 6 immunoprecipitated from intact cells by addition of anti-mouse GH to either the apical or basolateral 7 compartments for 2 h at 4°C. After extensive washing to remove the excessive antibody, the cells 8 were solubilized on the filters by the addition of TX-100 extracts of nonlabelled transfected MDCK 9 cells and the antigen-antibody complex was captured by protein A-Sepahrose. The D o w n lo 10 immunoprecipitates were analyzed by SDS-PAGE according to Laemmli (31). After electrophoresis ad e d fro m 11 the gels were fixed, soaked in 16% salicylic acid for signal amplification and subjected to h ttp ://w 12 fluorography, or quantified using a phosphorimager (Bio-Rad, Munich, FRG). w w .jb c .o 13 Analysis of the glycosylation pattern of the chimeras – The presence of N-linked glycans in the rg b/ y g u 14 the various protein chimeras was analyzed by treatment of the immunoprecipitated biosynthetically- est o n A p 15 labeled proteins with endo H or endo F followed by SDS-PAGE on essentially according to Naim et ril 3 , 2 0 1 16 al. (18). Following electrophoresis the radioactive bands were visualized using a phosphorimager 9 17 (Bio Rad, Munich, Germany) or autoradiography. The presence of O-linked glycans in the protein 18 chimeras was examined by biosynthetic labeling MDCK cells expressing the various chimeras in the 19 presence or absence of 6 mM benzyl-GalNAc (Sigma, Deisenhofen, Germany), an inhibitor of O- 20 glycosylation (32) as described by Alfalah et al. (20). 21 Association of the rGH-SI chimeras with membrane microdomains – The association of the 22 various protein chimeras with sphingolipid/cholesterol-rich microdomains was assessed in detergent 23 extractability assays using TX-100 essentially as described before (20). Here, the cells were 24 subjected to a pulse-chase protocol and solubilized for 2 h at 4°C in a lysis buffer containing 1 % 10