Logout succeed
Logout succeed. See you again!
Biological Science PDF
Preview Biological Science
S ince its trailblazing First Edition, Biological Science has delivered numerous biology teaching innovations that emphasize higher-order thinking skills and conceptual understanding rather than an encyclopedic grasp of what is known about biology. With each edition, this approach has grown and improved to better help students make the shift from being novice learners to expert learners. Central to this shift is a student-centered approach that provides deep support for the learning of core content and the development of key skills that help students learn and practice biology. This model represents the . . . ultimately . . . to become . . . and then to apply overarching goal of the Sixth completing the course active learners what they have learned Edition: To help novice learners as expert learners who through practice . . . to new situations . . . progress from instruction . . . think like biologists. Instruction Practice Application Content Skills TThinking like a biologist On the pages that follow, we will show how the text and MasteringBiology resources work together to achieve this goal. Unique Chapter-opening Roadmaps set the table for learning by visually grouping and organizing information to help students anticipate key ideas as well as recognize meaningful relationships and connections that are explored in the chapter that follows. 1 Biology and the Tree of Life Each Roadmap begins with a statement of why the chapter topic is important. This vervet monkey In this chapter you will learn about baby is exploring Key themes to structure your thinking about biology its new world and learning how to find starting with including including food and stay alive. It What does it mean Three of the greatest The process of represents one of the to say that something unifying ideas in biology doing biology 1.6 key characteristics of is alive? 1.1 life introduced in this Key topics from each chapter—replication. first second and third chapter are previewed, and Life is cellular 1.2 Life evolves 1.3 Life processes information 1.4 related ideas are connected both predict through linking words. The tree of life 1.5 I n essence, biological science is the study of life. It searches for ideas and observations that unify our understanding of the diversity of life—from bacteria living in hot springs to humans and majestic sequoia trees. Chapter section numbers The goals of this chapter are to introduce the nature of life and explore how biologists go about study- help students find key ideas ing it. The chapter also introduces themes that will resonate throughout this book: • Analyzing how organisms work at the molecular level. easily in the chapter. • Understanding organisms in terms of their evolutionary history. This chapter is part of the • Helping you learn to think like a biologist. Big Picture. See how on pages 16–17. Let’s begin with what may be the most fundamental question of all: What is life? 1 Big Picture Concept Maps are referenced on the opening page of related chapters, pointing students to summary pages that help them synthesize challenging topics. Instruction Practice Application Big Picture Concept Maps integrate visuals and words to Content New Diversity Big Picture help students synthesize information about challenging topics in biology that span multiple chapters and units. Skills DIVERSITY OF LIFE Big Picture activities are available at MasteringBiology Viruses are enormously Zygomycetes TtlAoihfhrrergcies ahie nnaB-tiediosgaom t,mPh saie acno tiddnnuo rEhEmeuya sakprhtiaonhorts yhwa aeBrs.esa M itcssht,oieen sd rg tii vlaei,d- ing daetsinhogvi veot eeahmlnurrestest sei teo nr oleanvofeen,t o sdboinr ufgaac tllarl iiuevfaneed riiesm em dnpaoolt rtant Lmtlihvikueineyltg iaca onebTarilsml ruhdoeleaera bsnlarse od,nh t frue oueyttrnleergaigtreta oiinron teatrnisssorse ompfhrlhvosipesms;d MIGCZCYHLRGOYOOMTSRMEPIRYODCORSEMI DaTYnIEACdSO TA BTsHyffuoepoaasorkosvredeerie;de s mtisihntoor yocogmiapllnedulyh t dsfcchaueoleenu tr mgbat ahi- ansatnhhdt yaa tp feodrm cBealcletedr ipar oaknadr yAortcehsa eina .the domains γ-Proteobacteria Spirochaetes Multicellularity FUNGI BASIDIOMYCOTA bmanaudssi dhbirraoa;oc imknecstl,u fpduuen fgfbialls, Only some of the many lineages DOMAIN BMACyTcEoRpIAlasma Ascomycota oifBtnohfi rgitln ih mvkPiisiionnc rgtgteru e osrdeerkeg i(ttlasloasne i plie(sssr )maCe. cheYst ao iBacpuireot ece Sy arkiosnnil uc l2surl6u s1t–der3e3e )t.ed2h - is BSCCAFipcahyrmtcailraintnoimecoocrubbyhiotdaaaedciecsaettteeeteersrisiaa ASCOMYCOTA Fscitnraaoucclrfllmfeu-lleddi kss eea,p nmaos ntraoredsurse ccy luitsenus,a r;ase t THE BIG PICTUREAeUT(tbsmtgfophhrexhcrelnopuseaaelcend1234meCIo.t tnruf e t....ea c ,cB5cra ry Hrttte iCIttαoIaMYbflsh1iriosisndhhhgooeeonf.-eoe6iutEe ee eear pun tdanm wcsP– soinh r sCu r snro ,tk ls io5otfeo oiue.ranciotri dg henftc 1ontK olirBrtdlytegthiieoeeaec ure7cnfht reotieen eu t ut n hrah)egorthwYbaeee eel rooson eedf trxod adb tbotOhe onrc xi poaifcadd rinCbocoe ednghpbaflmtncoeUae x h ke nrinelypdeEhdnt dnia per ah ct sabxRorvls ietli holcaot.ehi obnswaeepohhxfaer k f e lwmt sltluoa lteterUoh,o u oessoi e bYplp n hpfewaft tabt l oN tlitileiscoeolannn“nau,thoie.u gh.it vwp sg ddeeDno s…pitrn oNetohri r p n na sraowualEneeoiss.rgtcwfn a wo u TR tttmoepc rhutrha e fdehaSerooe neel”yl lnfn sTes l aeo… E n dAwritpuAndrirochnhka Nojsw eeaywsgwDrllr yeerl eyfyoarmrtc saIfioinhu coN asbm upto rmaoheigm.Gofr r mraecr(ssaoacvopyhiloauslnnwar ionleo pasinTed w bsr asfahogvolmareen noiebait crnsnciochinmnna cta e nerestitAtcuneshs so h ptttm rmsotAathdrehe.poo)enrreeee.r asrircct ing arwrwhdekei inanixtiiettno ethhAs ga c. BE ossaucmhtmhwrckooaaTemtamacwfrneLhmoresobaosryanmeor i nmbrfnaaa ts efaseomdor imrninearnnm oaoccugnaEPpcefl ourylsoaphkmelou augren ngtnonael-knhrga i- ogebacrcttrsbactelneiaynenaipioe srue,rteicoiy gnieesytshunlntalsetloiltyneedeein onntladddssiseertgmrtse i aac eall lsxg ,cr oaeunppdt plantsDiatDDoOOmMMsAAIINN AECECFTLSPDERGFCDAWDBAKδαβεγRU----houauu-laphoCerniiiKrirPPiPpnaaPloPemaeroirngrnHdAiriarcttraoyalrmarnwaureolAdReogoo ooteeaoombfaranmeEYnmrnlmt titac tnramtla poereAemAsegci e mhlciangfaoassoolsdoohapolaahroaiiellnobbbfslbgcaegblenagielleadlaadlaheaadaaoeeatrxdccscsoasacelcseottalsttaaetnetttteeneeaetsaoserrrsrriitisiiaaaaaa MUafaeUapppuoCnnnlnlrrnntohcaoicidaidmlmhlcldnioodib kel knmroPt aaaluleoaseltreLunarploc u n sA ylfiaplfiamenuasmd Nuhrriisrcnnnei nTyosttahMgllsygg Sgelvlausiei e,v lc, stm meieLtc AeleotnllsNhPnlseu DetttrrlA a hoi vrPrNeat iLitI tbsyMA itlN AaoTtVLeuSaSrPCstaghcol uanrsorlsyaypmurDni pcgtmoMiuers estousaotauuslr l ceysg ahuilonlla lsilrSmol ipewtsaeo FdnslNstlseo-o rawtvoneeca rchls ootarrddil XERCSCCRFMRVSRUCSLHCWMACFHTAHPGCileaecepetrnieooehonloolyeohivaoonhvuotnrrnhlggddcotumoieomlrhrtveondlsidbenkinswloismaifwnn rarreunsssopiogeaae iewbwodkgtdcgdmnotse oosuhercrlwot eparghsoooeksiwrsawfjdpornhayaoetemtooaosrbsrfi eetedtdnoalolstlrtadreselreaesssnsrriestressrdlemssmdgslm.mste lsasieee dssswtsstslesl aoastlr.emssGNPSPGALLENYROAAEMEGDPLPENNNDEOCRRIEVNONTLTPDAUOOOSESS HYSTTTASPSOOSEOCLPESROSSTUGERROTTZLARMOOOAOSEMSMMARTCSO HEEMOSSZ::EOSA MToascATomiitCTo6svfrMToostGAsdicaATo3sltnnniiieerlppespepblc5ynhfhfhf0hfvhferennihacsycpi or oethreckleee,edeeoee0ledesenser geommhlllot0ltssaieuuesdaccrcccl ece ,u osoeiicrrupmmm0, smm0lponsd,sddnsiodii rieedb ,1tunnt eeeesep0r i0ht isc,,asioispsbdaaooo2nyrooot8v r nss nksss l0opiade,anai,,satsnode a,eessssss5 a , sgg ep0 ttreiiml inedpraontttddesntstddnneon,lreom es 0l r0sodmn getzcsatdddse ccddscebspmssdss0s c0oocd ri,ucnnll lgsiiitiispnhoi: mwuupuuvvvv vsr0olhssa wlrtcvdtlrikiiacomeeeddeenudiiesb edbtoomnopbisredghrltrrrrv:rrfcciiiieryueiszo oonna nbsseselsssaeoseeepoahi do:rpdeeeemggpneeddgcein, sasresblw n ao as ms aru de csc:stsoppp1llms owin v ,neii,sbmss,r pr,onn fn0hhheu e siaort a ,eaebeveeass0 yyynto:rbatsld eceaa :illls0etialuuusk ssr idsggr e , mmmt , ee,s 703 “You should be able to…” activities Big Picture topics include: encourage students to analyze • Doing Biology, pp. 16–17 • Evolution, pp. 516–517 important patterns within each Big • The Chemistry of Life, • NEW! Diversity of Life, Picture concept map. pp. 140–141 pp. 702–703 • Energy for Life, pp. 232–233 • Plant and Animal Form and • Genetic Information, Function, pp. 816–817 pp. 396–397 • Ecology, pp. 1162–1163 Big Picture concept map tutorials are challenging, higher-level activities that require students to build their own concept map and to answer questions about the content. They are automatically graded to make it easy for professors to assign. New to the Sixth Edition are tutorials on diversity. A wide variety of practice questions and exercises are designed to encourage readers to pause and test their understanding as they proceed through each chapter. All questions and exercises are highlighted in blue throughout the text. (a) Using the genetic code to predict an amino acid sequence (b) Your turn—a chance to practice using the genetic code Non-template strand Non-template strand 5′ATGGCCAATGACTTTCAA TAA 3′ 5′ATGCTGGAGGGGGTTAGACAT 3′ 3′ TACCGGTTA CTGAAAGTT ATT5′ 3′ TACGACCTCCCCCAATCTGTA5′ Template strand of the DNA sequence ... Template strand of the DNA sequence ... 5′.A.. wUouGld GbeC traCnscAribAedU asGACUUUCAA UAA 3′ 5′... would be transcribed as 3′ Figure and table caption ... and translated as ... and translated as questions and exercises Met (start)Ala Asn Asp Phe Gln (stop) Remember that RNA contains U (uracil) instead of T (thymine), ask students to critically and that U forms a complementary base pair with A (adenine) Figure 16.7 The Genetic Code Can Predict Amino Acid Sequences. The strand of DNA that is transcribed is the examine information in figures template strand, and the strand of DNA that is not transcribed is the non-template strand. The non-template strand has the same polarity and sequence as the RNA except that where a T occurs in DNA, a U is found in RNA. Fill in the mRNA and amino acid sequences in part (b). and tables. • The code is non-overlapping. Once the ribosome locks Once biologists understood the central dogma and genetic onto the first codon, the reading frame is established, and the code, they were able to explore and eventually understand the ribosome then reads each separate codon one after another. molecular basis of mutation. How do novel traits—such as dwarf- • The code is nearly universal. With a few minor exceptions, ing in garden peas and white eye color in fruit flies—come to be? all codons specify the same amino acids in all organisms. • The code is conservative. When several codons specify the CHECK YOUR UNDERSTANDING Check Your Understanding same amino acid, the first two bases in those codons are usu- ally identical. If you understand that … activities ask students to The last point is subtle, but important. Here’s the key: If a • Tcohme sbeinqauteionncse o of ft hbraesee sb ains emsR sNpeAc cifoy nsspteitucitfeics aam ciondoe a. cPidasrt iicnu tlhaer change in DNA sequence leads to a change in the third position protein encoded by the gene. work with important concepts of a codon, it is less likely to alter the amino acid in the final • The genetic code is redundant. There are 64 combinations of protein. This feature makes individuals less vulnerable to single bases, but only 20 amino acids plus start and stop “punctuation in the chapter. base changes in their DNA sequences. Compared with randomly marks” need to be specified. gneontyepraict eedf fceocdtse so, ft hsem eaxlli stailntegr agetinoentsi ci nco dDeN Am isneiqmuieznesc et.h eS tpahteed- You should be able to … another way, the genetic code was not assembled randomly, like 1. Underline the start and stop codons in the mRNA sequence alentdte irss r dermaawrnk afrbolym e aff ihcaietn. Itt. has been honed by natural selection 2. Q5co'U-uAUlNdAT UcITCoAdCTeIAV fEUo GSr ttGhaCtee Af hoCollUowwU miUnaAgn AayAm dCiinf-f3oe' raecnitd m seRqNuAe nsceeq upelunsc eas Tthhee cVeanlturea lo dfo Kgnmoaw, ibnigo ltohgeis tCso cdaen Knowing the genetic code and sMtoept- Tcropd-Conys:-(Stop) 1. Predict the codons and amino acid sequence encoded by a Answers are available in Appendix A. particular DNA sequence (see Figure 16.7). 2. Determine the set of mRNA and DNA sequences that could code for a particular sequence of amino acids. 16.4 What Are the Types and Why are a set of mRNA or DNA sequences predicted from a Consequences of Mutation? given amino acid sequence? The answer lies in the code’s redun- dancy. For example, if a polypeptide contains phenylalanine, you This chapter has explained that the information in DNA is put RESEARCH Research boxes teach students how QUESTION: Is the inheritance of seed shape in peas affected by whether the genetic determinant comes from a male or female gamete? we know what we know about biology by HYPOTHESIS: The type of gamete does affect the inheritance of seed shape. NULL HYPOTHESIS: The type of gamete does not affect the inheritance of seed shape. using current and classic research to model EXPERIMENTAL SETUP: the observational and hypothesis-testing Pollen from round- A cross ... to female organ of Round-seeded parent The reciprocal cross... from wrinkled- seeded parent ... wrinkled-seeded parent. receives pollen ... seeded parent. process of scientific discovery. Male parent Female parent Female parent Male parent PREDICTION OF “SEX MATTERS” HYPOTHESIS: Offspring phenotypes will be different in the two crosses. PREDICTION OF NULL HYPOTHESIS: Offspring phenotypes will be identical in the two crosses. Each Research box concludes with a RESULTS: question or exercise that asks students Results are identical to think critically about experimental design First cross: All progeny have round seeds. Reciprocal cross: All progeny have round seeds. by predicting outcomes, analyzing the setup CONCLUSION: It makes no difference whether the genetic determinant for seed shape comes from the male gamete or from the female gamete. used to test a hypothesis, or interpreting Figure 14.3 Mendel Also Performed a Reciprocal Cross. SOURCE: Mendel, G. 1866. Versuche über Pflanzen-hybriden. Verhandlungen des naturforschenden Vereines in Brünn 4: 3–47. English translation available from ESP: data found in experimental results Electronic Scholarly Publishing (www.esp.org). PROCESS OF SCIENCE Some people think that experiments are failures if the hypothesis being tested is not supported. What does it mean to say that an experiment failed? Was this experiment a failure? “Solve It” Tutorials engage learners in a multi-step investigation of a “mystery” or open question in which students must analyze real data. Instruction Practice Application Content End of chapter case studies PUT IT ALL TOGETHER: Case Study with instructor Skills resources Steps to Building Understanding Each chapter ends with three groups of questions that build in difficulty TEST YOUR KNOWLEDGE Begin by testing your basic knowledge of new information. How does gigantism affect the physiology of animals? (cid:46)(cid:66)(cid:79)(cid:90)(cid:1)(cid:84)(cid:81)(cid:70)(cid:68)(cid:74)(cid:70)(cid:84)(cid:1)(cid:80)(cid:71)(cid:1)(cid:66)(cid:79)(cid:74)(cid:78)(cid:66)(cid:77)(cid:84)(cid:1)(cid:80)(cid:79)(cid:1)(cid:74)(cid:84)(cid:77)(cid:66)(cid:79)(cid:69)(cid:84)(cid:1)(cid:66)(cid:83)(cid:70)(cid:1)(cid:77)(cid:66)(cid:83)(cid:72)(cid:70)(cid:83)(cid:1)(cid:85)(cid:73)(cid:66)(cid:79)(cid:1)(cid:83)(cid:70)(cid:77)(cid:66)(cid:85)(cid:70)(cid:69)(cid:1)(cid:84)(cid:81)(cid:70)(cid:68)(cid:74)(cid:70)(cid:84)(cid:1)(cid:80)(cid:79)(cid:1) TEST YOUR UNDERSTANDING (cid:85)(cid:73)(cid:70)(cid:1)(cid:78)(cid:66)(cid:74)(cid:79)(cid:77)(cid:66)(cid:79)(cid:69)(cid:15)(cid:1)(cid:52)(cid:68)(cid:74)(cid:70)(cid:79)(cid:85)(cid:74)(cid:84)(cid:85)(cid:84)(cid:1)(cid:73)(cid:90)(cid:81)(cid:80)(cid:85)(cid:73)(cid:70)(cid:84)(cid:74)(cid:91)(cid:70)(cid:1)(cid:85)(cid:73)(cid:66)(cid:85)(cid:1)(cid:85)(cid:73)(cid:74)(cid:84)(cid:1)(cid:81)(cid:73)(cid:70)(cid:79)(cid:80)(cid:78)(cid:70)(cid:79)(cid:80)(cid:79)(cid:13)(cid:1)(cid:68)(cid:66)(cid:77)(cid:77)(cid:70)(cid:69)(cid:1) Once you’re confident with the basics, demonstrate (cid:74)(cid:84)(cid:77)(cid:66)(cid:79)(cid:69)(cid:1)(cid:72)(cid:74)(cid:72)(cid:66)(cid:79)(cid:85)(cid:74)(cid:84)(cid:78)(cid:13)(cid:1)(cid:70)(cid:87)(cid:80)(cid:77)(cid:87)(cid:70)(cid:69)(cid:1)(cid:74)(cid:79)(cid:1)(cid:83)(cid:70)(cid:84)(cid:81)(cid:80)(cid:79)(cid:84)(cid:70)(cid:1)(cid:85)(cid:80)(cid:1)(cid:85)(cid:73)(cid:70)(cid:1)(cid:84)(cid:68)(cid:66)(cid:83)(cid:68)(cid:74)(cid:85)(cid:90)(cid:1)(cid:80)(cid:71)(cid:1)(cid:68)(cid:80)(cid:78)(cid:81)(cid:70)(cid:85)(cid:74)(cid:85)(cid:80)(cid:83)(cid:84)(cid:1) your deeper understanding of the material. (cid:66)(cid:79)(cid:69)(cid:1)(cid:81)(cid:83)(cid:70)(cid:69)(cid:66)(cid:85)(cid:80)(cid:83)(cid:84)(cid:1)(cid:80)(cid:79)(cid:1)(cid:74)(cid:84)(cid:77)(cid:66)(cid:79)(cid:69)(cid:84)(cid:15)(cid:1)(cid:51)(cid:70)(cid:69)(cid:86)(cid:68)(cid:70)(cid:69)(cid:1)(cid:68)(cid:80)(cid:78)(cid:81)(cid:70)(cid:85)(cid:74)(cid:85)(cid:74)(cid:80)(cid:79)(cid:1)(cid:66)(cid:79)(cid:69)(cid:1)(cid:81)(cid:83)(cid:70)(cid:69)(cid:66)(cid:85)(cid:74)(cid:80)(cid:79)(cid:1)(cid:66)(cid:77)(cid:77)(cid:80)(cid:88)(cid:84)(cid:1) (cid:84)(cid:81)(cid:70)(cid:68)(cid:74)(cid:70)(cid:84)(cid:1)(cid:85)(cid:80)(cid:1)(cid:70)(cid:89)(cid:81)(cid:77)(cid:80)(cid:74)(cid:85)(cid:1)(cid:78)(cid:80)(cid:83)(cid:70)(cid:1)(cid:83)(cid:70)(cid:84)(cid:80)(cid:86)(cid:83)(cid:68)(cid:70)(cid:84)(cid:1)(cid:66)(cid:79)(cid:69)(cid:1)(cid:71)(cid:83)(cid:70)(cid:70)(cid:84)(cid:1)(cid:85)(cid:73)(cid:70)(cid:78)(cid:1)(cid:71)(cid:83)(cid:80)(cid:78)(cid:1)(cid:85)(cid:73)(cid:70)(cid:1)(cid:79)(cid:70)(cid:70)(cid:69)(cid:1)(cid:85)(cid:80)(cid:1) (cid:73)(cid:74)(cid:69)(cid:70)(cid:1)(cid:74)(cid:79)(cid:1)(cid:84)(cid:78)(cid:66)(cid:77)(cid:77)(cid:1)(cid:83)(cid:70)(cid:71)(cid:86)(cid:72)(cid:70)(cid:84)(cid:15) TEST YOUR PROBLEM-SOLVING SKILLS 11. QUANTITATIVE(cid:1)(cid:53)(cid:73)(cid:70)(cid:1)(cid:72)(cid:83)(cid:66)(cid:81)(cid:73)(cid:1)(cid:84)(cid:73)(cid:80)(cid:88)(cid:79)(cid:1)(cid:73)(cid:70)(cid:83)(cid:70)(cid:1)(cid:68)(cid:80)(cid:78)(cid:81)(cid:66)(cid:83)(cid:70)(cid:84)(cid:1)(cid:85)(cid:73)(cid:70)(cid:1)(cid:1)(cid:66)(cid:87)(cid:70)(cid:83)(cid:66)(cid:72)(cid:70)(cid:1) Work towards mastery of the content by answering questions (cid:1)(cid:68)(cid:66)(cid:83)(cid:66)(cid:81)(cid:66)(cid:68)(cid:70)(cid:1)(cid:9)(cid:84)(cid:73)(cid:70)(cid:77)(cid:77)(cid:10)(cid:1)(cid:77)(cid:70)(cid:79)(cid:72)(cid:85)(cid:73)(cid:1)(cid:80)(cid:71)(cid:1)(cid:78)(cid:66)(cid:74)(cid:79)(cid:77)(cid:66)(cid:79)(cid:69)(cid:1)(cid:66)(cid:79)(cid:69)(cid:1)(cid:74)(cid:84)(cid:77)(cid:66)(cid:79)(cid:69)(cid:1)(cid:85)(cid:80)(cid:83)(cid:85)(cid:80)(cid:74)(cid:84)(cid:70)(cid:84)(cid:15)(cid:1) that challenge you at the highest level of competency. (cid:52)(cid:86)(cid:78)(cid:78)(cid:66)(cid:83)(cid:74)(cid:91)(cid:70)(cid:1)(cid:85)(cid:73)(cid:70)(cid:1)(cid:83)(cid:70)(cid:84)(cid:86)(cid:77)(cid:85)(cid:84)(cid:1)(cid:9)(cid:11)(cid:11)(cid:11)(cid:1)(cid:78)(cid:70)(cid:66)(cid:79)(cid:84)(cid:1)P(cid:1)6(cid:1)(cid:17)(cid:15)(cid:17)(cid:17)(cid:18)(cid:13)(cid:1)(cid:84)(cid:70)(cid:70)(cid:1)BioSkills 3(cid:10)(cid:13)(cid:1) then use the da(cid:85)(cid:66)(cid:1)(cid:85)(cid:80)(cid:1)(cid:81)(cid:83)(cid:70)(cid:69)(cid:74)(cid:68)(cid:85)(cid:1)(cid:88)(cid:73)(cid:70)(cid:85)(cid:73)(cid:70)(cid:83)(cid:1)(cid:85)(cid:73)(cid:70)(cid:1)(cid:84)(cid:86)(cid:83)(cid:71)(cid:66)(cid:68)(cid:70)(cid:1)(cid:66)(cid:83)(cid:70)(cid:66)(cid:16)(cid:87)(cid:80)(cid:77)(cid:86)(cid:78)(cid:70)(cid:1) (cid:1)(cid:83)(cid:66)(cid:85)(cid:74)(cid:80)(cid:1)(cid:74)(cid:84)(cid:1)(cid:73)(cid:74)(cid:72)(cid:73)(cid:70)(cid:83)(cid:1)(cid:74)(cid:79)(cid:1)(cid:78)(cid:66)(cid:74)(cid:79)(cid:77)(cid:66)(cid:79)(cid:69)(cid:1)(cid:80)(cid:83)(cid:1)(cid:74)(cid:84)(cid:77)(cid:66)(cid:79)(cid:69)(cid:1)(cid:85)(cid:80)(cid:83)(cid:85)(cid:80)(cid:74)(cid:84)(cid:70)(cid:84)(cid:15) *** m) 100 c h ( 80 gt n 60 NEW! “Put It All Together” case studies appear at e e l 40 the end of every chapter and provide a brief summary of c a contemporary biology research in action. Each case study ap 20 r a connects what students learn in class with current, real-world C 0 Island Mainland biology research questions. At least one question requires tortoises tortoises students to analyze real data or apply quantitative skills. (cid:1)Source:(cid:1)(cid:43)(cid:66)(cid:71)(cid:71)(cid:70)(cid:13)(cid:1)(cid:34)(cid:15)(cid:1)(cid:45)(cid:15)(cid:13)(cid:1)(cid:40)(cid:15)(cid:1)(cid:43)(cid:15)(cid:1)(cid:52)(cid:77)(cid:66)(cid:85)(cid:70)(cid:83)(cid:13)(cid:1)(cid:66)(cid:79)(cid:69)(cid:1)(cid:46)(cid:15)(cid:1)(cid:38)(cid:15)(cid:1)(cid:34)(cid:77)(cid:71)(cid:66)(cid:83)(cid:80)(cid:15)(cid:1)(cid:19)(cid:17)(cid:18)(cid:18)(cid:15)(cid:1)Biology Letters(cid:1)(cid:24)(cid:27)(cid:1)(cid:22)(cid:22)(cid:25)(cid:109)(cid:22)(cid:23)(cid:18)(cid:15)(cid:1) 12. (cid:56)(cid:73)(cid:74)(cid:68)(cid:73)(cid:1)(cid:85)(cid:80)(cid:83)(cid:85)(cid:80)(cid:74)(cid:84)(cid:70)(cid:84)(cid:13)(cid:1)(cid:78)(cid:66)(cid:74)(cid:79)(cid:77)(cid:66)(cid:79)(cid:69)(cid:1)(cid:80)(cid:83)(cid:1)(cid:74)(cid:84)(cid:77)(cid:66)(cid:79)(cid:69)(cid:13)(cid:1)(cid:79)(cid:70)(cid:70)(cid:69)(cid:1)(cid:85)(cid:80)(cid:1)(cid:70)(cid:66)(cid:85)(cid:1)(cid:78)(cid:80)(cid:83)(cid:70)(cid:1)(cid:71)(cid:80)(cid:80)(cid:69)(cid:1)(cid:81)(cid:70)(cid:83)(cid:1) (cid:72)(cid:83)(cid:66)(cid:78)(cid:1)(cid:80)(cid:71)(cid:1)(cid:85)(cid:73)(cid:70)(cid:74)(cid:83)(cid:1)(cid:67)(cid:80)(cid:69)(cid:90)(cid:1)(cid:78)(cid:66)(cid:84)(cid:84)(cid:32) 13. (cid:56)(cid:73)(cid:74)(cid:68)(cid:73)(cid:1)(cid:80)(cid:71)(cid:1)(cid:85)(cid:73)(cid:70)(cid:1)(cid:71)(cid:80)(cid:77)(cid:77)(cid:80)(cid:88)(cid:74)(cid:79)(cid:72)(cid:1)(cid:78)(cid:74)(cid:72)(cid:73)(cid:85)(cid:1)(cid:67)(cid:70)(cid:1)(cid:66)(cid:1)(cid:85)(cid:83)(cid:66)(cid:69)(cid:70)(cid:14)(cid:80)(cid:71)(cid:71)(cid:1)(cid:80)(cid:71)(cid:1)(cid:72)(cid:74)(cid:72)(cid:66)(cid:79)(cid:85)(cid:74)(cid:84)(cid:78)(cid:1) (cid:1)(cid:70)(cid:89)(cid:81)(cid:70)(cid:83)(cid:74)(cid:70)(cid:79)(cid:68)(cid:70)(cid:69)(cid:1)(cid:67)(cid:90)(cid:1)(cid:72)(cid:74)(cid:66)(cid:79)(cid:85)(cid:1)(cid:74)(cid:84)(cid:77)(cid:66)(cid:79)(cid:69)(cid:1)(cid:85)(cid:80)(cid:83)(cid:85)(cid:80)(cid:74)(cid:84)(cid:70)(cid:84)(cid:32) a. (cid:53)(cid:73)(cid:70)(cid:90)(cid:1)(cid:68)(cid:80)(cid:80)(cid:77)(cid:1)(cid:87)(cid:70)(cid:83)(cid:90)(cid:1)(cid:83)(cid:66)(cid:81)(cid:74)(cid:69)(cid:77)(cid:90)(cid:1)(cid:69)(cid:86)(cid:83)(cid:74)(cid:79)(cid:72)(cid:1)(cid:68)(cid:80)(cid:77)(cid:69)(cid:1)(cid:88)(cid:70)(cid:66)(cid:85)(cid:73)(cid:70)(cid:83)(cid:15) b. (cid:42)(cid:85)(cid:1)(cid:88)(cid:80)(cid:86)(cid:77)(cid:69)(cid:1)(cid:67)(cid:70)(cid:1)(cid:69)(cid:74)(cid:71)(cid:71)(cid:74)(cid:68)(cid:86)(cid:77)(cid:85)(cid:1)(cid:85)(cid:80)(cid:1)(cid:84)(cid:86)(cid:84)(cid:85)(cid:66)(cid:74)(cid:79)(cid:1)(cid:85)(cid:73)(cid:70)(cid:74)(cid:83)(cid:1)(cid:73)(cid:74)(cid:72)(cid:73)(cid:1)(cid:78)(cid:66)(cid:84)(cid:84)(cid:14)(cid:84)(cid:81)(cid:70)(cid:68)(cid:74)(cid:71)(cid:74)(cid:68)(cid:1) (cid:78)(cid:70)(cid:85)(cid:66)(cid:67)(cid:80)(cid:77)(cid:74)(cid:68)(cid:1)(cid:83)(cid:66)(cid:85)(cid:70)(cid:84)(cid:1)(cid:80)(cid:79)(cid:1)(cid:66)(cid:1)(cid:69)(cid:74)(cid:70)(cid:85)(cid:1)(cid:80)(cid:71)(cid:1)(cid:81)(cid:77)(cid:66)(cid:79)(cid:85)(cid:84)(cid:1)(cid:66)(cid:77)(cid:80)(cid:79)(cid:70)(cid:15) c. (cid:42)(cid:85)(cid:1)(cid:68)(cid:80)(cid:86)(cid:77)(cid:69)(cid:1)(cid:67)(cid:70)(cid:1)(cid:78)(cid:80)(cid:83)(cid:70)(cid:1)(cid:69)(cid:74)(cid:71)(cid:71)(cid:74)(cid:68)(cid:86)(cid:77)(cid:85)(cid:1)(cid:85)(cid:80)(cid:1)(cid:66)(cid:87)(cid:80)(cid:74)(cid:69)(cid:1)(cid:85)(cid:73)(cid:70)(cid:83)(cid:78)(cid:66)(cid:77)(cid:77)(cid:90)(cid:1)(cid:86)(cid:79)(cid:71)(cid:66)(cid:87)(cid:80)(cid:83)(cid:66)(cid:67)(cid:77)(cid:70)(cid:1) (cid:68)(cid:80)(cid:79)(cid:69)(cid:74)(cid:85)(cid:74)(cid:80)(cid:79)(cid:84)(cid:15) d. (cid:53)(cid:73)(cid:70)(cid:90)(cid:1)(cid:68)(cid:80)(cid:86)(cid:77)(cid:69)(cid:1)(cid:73)(cid:74)(cid:69)(cid:70)(cid:1)(cid:71)(cid:83)(cid:80)(cid:78)(cid:1)(cid:79)(cid:80)(cid:79)(cid:79)(cid:66)(cid:85)(cid:74)(cid:87)(cid:70)(cid:1)(cid:81)(cid:83)(cid:70)(cid:69)(cid:66)(cid:85)(cid:80)(cid:83)(cid:84)(cid:1)(cid:78)(cid:80)(cid:83)(cid:70)(cid:1)(cid:70)(cid:66)(cid:84)(cid:74)(cid:77)(cid:90)(cid:15) 14. CAUTION(cid:1)(cid:53)(cid:83)(cid:86)(cid:70)(cid:1)(cid:80)(cid:83)(cid:1)(cid:71)(cid:66)(cid:77)(cid:84)(cid:70)(cid:27)(cid:1)(cid:53)(cid:73)(cid:70)(cid:1)(cid:67)(cid:80)(cid:69)(cid:90)(cid:1)(cid:85)(cid:70)(cid:78)(cid:81)(cid:70)(cid:83)(cid:66)(cid:85)(cid:86)(cid:83)(cid:70)(cid:84)(cid:1)(cid:80)(cid:71)(cid:1)(cid:74)(cid:84)(cid:77)(cid:66)(cid:79)(cid:69)(cid:1)(cid:85)(cid:80)(cid:83)(cid:85)(cid:80)(cid:74)(cid:84)(cid:70)(cid:84)(cid:1) NEW! Case study questions from the end of chapter are (cid:66)(cid:77)(cid:88)(cid:66)(cid:90)(cid:84)(cid:1)(cid:68)(cid:77)(cid:80)(cid:84)(cid:70)(cid:77)(cid:90)(cid:1)(cid:78)(cid:66)(cid:85)(cid:68)(cid:73)(cid:1)(cid:85)(cid:73)(cid:70)(cid:1)(cid:85)(cid:70)(cid:78)(cid:81)(cid:70)(cid:83)(cid:66)(cid:85)(cid:86)(cid:83)(cid:70)(cid:84)(cid:1)(cid:74)(cid:79)(cid:1)(cid:85)(cid:73)(cid:70)(cid:74)(cid:83)(cid:1)(cid:70)(cid:79)(cid:87)(cid:74)(cid:83)(cid:80)(cid:79)(cid:78)(cid:70)(cid:79)(cid:85)(cid:84)(cid:15) assignable in MasteringBiology. 15. (cid:52)(cid:86)(cid:81)(cid:81)(cid:80)(cid:84)(cid:70)(cid:1)(cid:85)(cid:73)(cid:66)(cid:85)(cid:1)(cid:66)(cid:1)(cid:84)(cid:78)(cid:66)(cid:77)(cid:77)(cid:1)(cid:78)(cid:66)(cid:74)(cid:79)(cid:77)(cid:66)(cid:79)(cid:69)(cid:1)(cid:85)(cid:80)(cid:83)(cid:85)(cid:80)(cid:74)(cid:84)(cid:70)(cid:1)(cid:66)(cid:79)(cid:69)(cid:1)(cid:66)(cid:1)(cid:77)(cid:66)(cid:83)(cid:72)(cid:70)(cid:1)(cid:74)(cid:84)(cid:77)(cid:66)(cid:79)(cid:69)(cid:1) (cid:1)tortoise are placed in the same pen a(cid:85)(cid:1)(cid:66)(cid:1)(cid:91)(cid:80)(cid:80)(cid:15)(cid:1)(cid:56)(cid:73)(cid:74)(cid:68)(cid:73)(cid:1)(cid:85)(cid:80)(cid:83)(cid:85)(cid:80)(cid:74)(cid:84)(cid:70)(cid:1) NEW! Classroom activity questions about the case study will be more (cid:1)(cid:81)(cid:80)(cid:74)(cid:76)(cid:74)(cid:77)(cid:80)(cid:85)(cid:73)(cid:70)(cid:83)(cid:78)(cid:74)(cid:68)(cid:13)(cid:1)(cid:85)(cid:73)(cid:70)(cid:1)(cid:84)(cid:78)(cid:66)(cid:77)(cid:77)(cid:1)(cid:80)(cid:83)(cid:1)(cid:77)(cid:66)(cid:83)(cid:72)(cid:70)(cid:1)(cid:85)(cid:80)(cid:83)(cid:85)(cid:80)(cid:74)(cid:84)(cid:70)(cid:32)(cid:1)(cid:56)(cid:73)(cid:90)(cid:32) are available for clickers to help instructors easily incorporate 16. CAUTION(cid:1)(cid:48)(cid:79)(cid:1)(cid:66)(cid:1)(cid:85)(cid:83)(cid:74)(cid:81)(cid:1)(cid:85)(cid:80)(cid:1)(cid:85)(cid:73)(cid:70)(cid:1)(cid:40)(cid:66)(cid:77)(cid:198)(cid:81)(cid:66)(cid:72)(cid:80)(cid:84)(cid:1)(cid:42)(cid:84)(cid:77)(cid:66)(cid:79)(cid:69)(cid:84)(cid:13)(cid:1)(cid:90)(cid:80)(cid:86)(cid:1)(cid:80)(cid:87)(cid:70)(cid:83)(cid:73)(cid:70)(cid:66)(cid:83)(cid:1)(cid:66)(cid:1)(cid:72)(cid:83)(cid:80)(cid:86)(cid:81)(cid:1) the case studies into their classroom teaching. (cid:80)(cid:71)(cid:1)(cid:85)(cid:80)(cid:86)(cid:83)(cid:74)(cid:84)(cid:85)(cid:84)(cid:1)(cid:83)(cid:70)(cid:71)(cid:70)(cid:83)(cid:1)(cid:85)(cid:80)(cid:1)(cid:85)(cid:80)(cid:83)(cid:85)(cid:80)(cid:74)(cid:84)(cid:70)(cid:84)(cid:1)(cid:66)(cid:84)(cid:1)(cid:105)(cid:68)(cid:80)(cid:77)(cid:69)(cid:1)(cid:67)(cid:77)(cid:80)(cid:80)(cid:69)(cid:70)(cid:69)(cid:15)(cid:117)(cid:1)(cid:38)(cid:89)(cid:81)(cid:77)(cid:66)(cid:74)(cid:79)(cid:1)(cid:88)(cid:73)(cid:90)(cid:1)(cid:85)(cid:73)(cid:74)(cid:84)(cid:1) (cid:88)(cid:80)(cid:83)(cid:69)(cid:1)(cid:74)(cid:84)(cid:1)(cid:79)(cid:80)(cid:85)(cid:1)(cid:66)(cid:68)(cid:68)(cid:86)(cid:83)(cid:66)(cid:85)(cid:70)(cid:1)(cid:85)(cid:80)(cid:1)(cid:69)(cid:70)(cid:84)(cid:68)(cid:83)(cid:74)(cid:67)(cid:70)(cid:1)(cid:66)(cid:1)(cid:72)(cid:74)(cid:66)(cid:79)(cid:85)(cid:1)(cid:85)(cid:80)(cid:83)(cid:85)(cid:80)(cid:74)(cid:84)(cid:70)(cid:15) Instruction Practice Application Content Expanded BioSkills moved Skills to the front of the book NEW! Unique BioSkills reference section is BioSkills now placed earlier in the text to draw attention to key skills students need to succeed in biology. In this book you will learn that BioSkills Asking Questions and Designing Studies are essential for doing biology starting with Previously located in an appendix at the end Chapter 1: Introduces core principles and best practices BigPicture 1: Provides a visual summary of how to think like a biologist The narrative throughout the text models how to think like a biologist, of the text, this easy-to-find reference material including end-of-chapter case studies. Experiment boxes, graphs, and other visual models in each chapter help you to visualize scientific ideas. now follows Chapter 1 to better support the then using this BioSkills section to review and practice with development of skills throughout the course. Quantifying Biology Using Common Lab Tools Visualizing Biology Reading Biology Each BioSkill includes practice exercises. 1: Using the Metric System and 6: Separating and Visualizing 12: Reading and Making Visual 15: Translating Greek and Latin Significant Figures Molecules Models Roots in Biology 2: Reading and Making Graphs 7: Separating Cell Compo- 13: Reading and Making 16: Reading and Citing the 3: IBnatersr parnedti nUgs iSntga nSdtaatrids tEicrarol r n ebny tCsentrifugation 14: RPehayldoignegn Cehtiecm Tirceaels Primary Literature Tests 8: Using Spectrophotometry Structures 4: Working with Probabilities 9: Using Microscopy See 2: Reading and Making 5: Using Logarithms 10: Using Molecular Biology Graphs Tools and Techniques 11: Using Cell Culture and wsuhcecreess wsuhcecreess Model Organisms as Tools requires requires Monitoring Your Own Learning where success requires 17: Recognizing and Correcting Misconceptions Table B3.1 Asterisk Rating System for P Values and Statistical Significance 18: Using Bloom’s Taxonomy for Study Success P Value Asterisk Rating Statistical Significance Level Meaning 1188 P > 0.05 None Not significant Greater than a 1 in 20 chance of being wrong (i.e., incorrect rejection of the null hypothesis) P < 0.05 * Statistically significant Less than a 1 in 20 chance of being wrong P < 0.01 ** Statistically significant Less than a 1 in 100 chance of being wrong P < 0.001 *** Statistically significant Less than a 1 in 1000 chance of being wrong EXPANDED! BioSkill on Interpreting Standard Error Bars and Using Statistical Tests includes a new discussion of commonly used tests, such as chi square, t-test, and analysis of variance (ANOVA). A new section discusses interpreting P values and statistical significance. BioSkills review questions are available in the Study Area for self-paced learning and practice. Additional BioSkills questions in the item library are assignable for homework. Instruction Practice Application Making Models 25.1 Tips on Drawing Phylogenetic Trees Content Model-based reasoning boxes, videos, The closeness of taxon labels cannot be used to determine and aligned questions added throughout book and in MasteringBiology relationships among taxa. To understand why, you must view and Skills draw trees as flexible models that can rotate at each node (like mobiles hanging from a ceiling) rather than as a static structures. Atlantic Sockeye Pink Pink Sockeye King NEW! Unique Making Models boxes King Coho appear at strategic points throughout chapters as a guide for developing a Coho Atlantic deeper understanding of biology concepts These trees have the same meaning. by interpreting and creating visual models. MODEL Draw one more “equivalent” tree with the same meaning as the two above, rotating one or more of the nodes. To see this model in action, go to https://goo.gl/mskc9S Readers can access the videos via QR codes, through the eText, or in the Study Area of MasteringBiology. NEW! Interactive whiteboard videos accompany each Making Models box to reinforce learning and to demonstrate how to build visual models. NEW! Making Models activities are assignable for homework and include the whiteboard videos plus application questions that help in developing the skills of interpreting visual models. Informed by current science education research and Instruction Practice Application curriculum reform strategies, the Sixth Edition instructor resources For instructors, assessment Content matrix with Bloom’s rankings, provide a broad range of easy-to-use assessment options. learning outcomes, and Vision and Change core concept and Skills competency tags NEW! Chapter Assessment Grids help instructors quickly identify suitable assessment questions in the text according to learning outcomes, Bloom’s taxonomy ranking, core concepts and core competencies discussed in the Vision and Change in Undergraduate Biology Education report, and, when applicable, common student misconceptions. “Blue Thread” questions, including end-of-chapter problems, are ranked BLOOMS TAXONOMY RANKING according to Bloom’s taxonomy and are assignable in MasteringBiology. Each question is tagged to a publisher-provided Learning Outcome. LEARNING OUTCOMES Instructors may also track their own Learning Outcomes using MasteringBiology. NEW! When applicable, common student misconceptions are addressed MISCONCEPTIONS and identified with targeted questions. NEW! Each question that covers a Core Concept from the Vision and Change VISION & CHANGE in Undergraduate Biology Education report is noted in the chapter assessment CORE CONCEPTS grid and in MasteringBiology. NEW! Core Competencies from the Vision and Change in Undergraduate VISION & CHANGE Biology Education report are indicated in the chapter assessment grid and in CORE COMPETENCIES MasteringBiology. EXPANDED! Questions, activities, and tutorials are tagged by Bloom’s ranking, Learning Outcome, and Vision and Change Core Concepts and Core Competencies. Instruction Practice Application Content Skill-based question tags Skills added to assessment An extensive selection of mid- and high-level assessment questions are provided throughout each chapter to help students learn, practice, and prepare for tests. THE GLOBAL NITROGEN CYCLE All estimated values in teragrams Major reservoir: (1012 grams) of nitrogen per year Atmospheric nitrogen (N2) Industrial pollution (78% of atmosphere) (NO, NO2): 40 Industrial production of fertilizer (120) and Nitrogen-fixing burning of fossil c1y4a0nobacteria: Bacteria in mud Lightning: 5 fuels (30): 150 use N-containing molecules as Reservoir: energy sources, Terrestrial excrete N2: 355 org1a2n0is0ms: Nini trrooogtesn a-nfidxi nsgo ibl:acteria Natural: 58 Cropppppppsssssssssssssssssssssss:::: 6666000 Positive Feedback Reservoir: Runoff: 80 regulation inhibition Aquatic org8a0n0is0ms: Decomposition Assimilation CRH Hypothalamus Permanent burial: 20 Ammonia (NH3), ammonium (NH4+), nitrate (NO3-) Apintuteitraioryr Figure 53.14 The Global Nitrogen Cycle. Nitrogen enters ecosystems as ammonia or nitrate via fixation from atmospheric nitrogen. It is exported in runoff and as nitrogen gas given off by bacteria that use nitrogen-containing ACTH Cortisol compounds as an electron acceptor. DATA: Fowler, D., et al. 2013. Philosophical Transactions of the Royal Society B 368 (1621): 20130165. Adrenal QUANTITATIVE Calculate the percentage of total nitrogen fixation (all downward-pointing arrows) that is caused gland by human activities (black arrows). Kidney Cortisol Targets tissues throughout body NEW! Question labels call attention to questions that require quantitative skills, an understanding of the Figure 46.14 The Interaction between Cortisol, ACTH, and CRH process of science, connecting biology and society, Is an Example of Feedback Inhibition. making models, and more. PROCESS OF SCIENCE Use the figure to devise a test for adrenal failure in humans. 5. CAUTION According to data presented in this chapter, which one of the following statements is correct? NEW! Caution questions address topics a. When individuals change in response to challenges from the for which students often hold common environment, their altered traits are passed on to offspring. misconceptions. Answers to Caution b. Species are created independently of each other and do not questions include information that change over time. addresses the misconception. c. Populations—not individuals—change when natural selection occurs. d. The traits of populations become more perfect over time.

