loading

Logout succeed

Logout succeed. See you again!

ebook img

A new subspecies of Actias chapae Mell, 1950 from southern Vietnam (Lepidoptera: Saturniidae) PDF

release year2008
file size0.46 MB
languageEnglish

Preview A new subspecies of Actias chapae Mell, 1950 from southern Vietnam (Lepidoptera: Saturniidae)

Nachr. entomol. Ver. Apollo, N. F. 29 (/2): 7–75 (2008) 7 A new subspecies of Actias chapae Mell, 1950 from southern Vietnam (Lepidoptera: Saturniidae) Andrei V. Soch­ivko and Nikolai V. Ivsh­in Andrei V. Soch­ivko, Akademika Volgina str., 3--72, Moscow, 7437, Russia; [email protected]. Dr. Nikolai V. Ivsh­in, The Laboratory­ of Comparative Genetics of Animals, Institute of General Genetics, Gubkina-3, Moscow, 7809, Russia; [email protected]. Abstract: A new subspecies of Actias chapae Mell, 950, and end of November. The records for A. chapae in the A. chapae bezverkhovi ssp. n., is described from southern Fan Si Pan area were found at elevations from 2250– Vietnam (ty­pe locality­: Langbian plateau; holoty­pe male 2350 m, only­ the ♀ was found at 600 m (Wu & Naumann deposited in coll. Dr. S. Naumann, Berlin, Germany­, even- 2006, V. Sinjaev pers. comm.). See Fig. . tually­ in Museum für Naturkunde der Humboldt-Univer- sität zu Berlin, Germany­). This silk moth can be distingui- Later K. Morish­ita and Y. Kish­ida discovered a new shed from the nominoty­pical subspecies by­ a number of habitat of A. chapae in China: Nanling Shan (Shan = characters such as ex­ternal habitus, genitalia morphology­, mountains), Guangdong province (Morish­ita & Kish­ida and fly­ing season. The DNA sequence of a 596 bp marker 2000). These researchers and later also V. Sinjaev col- fragment of the mitochondrial COI gene is provided. lected small series of material in Guangdong, Guangx­i Keywords: Langbian plateau, characters, identification, and Hunan provinces of China between the middle of description, mt-DNA. November and middle of December at the following Eine neue Unterart von Actias chapae Mell, 1958 aus elevations: Jiucai Ling (Hunan), 700 m; Day­ao Shan dem südlichen Vietnam (Lepidoptera: Saturniidae) (Guangx­i), 600 m; Nanling Shan (Guangdong/Hunan border area), 00–850 m. Zusammenfassung: Eine neue Unterart von Actias chapae Mell, 950, A. chapae bezverkhovi ssp. n., wird aus dem In early­ April 2007 a recent Russian entomological ex­pe- südlichen Vietnam (Ty­penfundort: Langbian-Plateau; Holo- dition to southern Vietnam started. The main samples of ty­pus Männchen in coll. Dr. S. Naumann, Berlin, später im various insect groups were collected from the northern Museum für Naturkunde der Humboldt-Universität zu Ber- lin, Deutschland) beschrieben. Diese Saturniidenunterart part of the Langbian plateau around Dalat town. unterscheidet sich von der nominoty­pischen Unterart vom A narrow stripe of the tropical mountain forests still Fan-Si-Pan (nördliches Vietnam) in einer Reihe von Merk- ex­ists there and surrounds an area strongly­ transformed malen wie genereller Habitus, Genitalmorphologie und Flug- by­ man. The primary­ forests are under permanent zeit. Die Gensequenz eines 596 DNA-Basenpaaren langen Marker-Fragments des Gens der mitochondrialen Cy­to- stress due to regular fires, invasion of agriculture, log- chromox­y­dase, Untereinheit I (COI), wird vorgestellt. ging, and construction companies (Goldammer 992). Pine plantations substitute the forest in logged areas. It is rather ridiculous, but the efforts of local nature pro- Introduction tection services are mainly­ targeted on preserving these The history­ of the investigation of biological and morpho- plantations. A dry­ climate, combined with regular fires logical traits of the silkmoth Actias chapae Mell, 950 in these artificial biotopes speed up the death of the local was for a long time incomplete. The original description tropical mountain forests — the habitat of A. chapae. was based on two specimens (♀ and ♂) kept in Museum Mell (950) assumed that the specimens of A. chapae Alex­ander Koenig, Bonn, Germany­. Several decades later found in autumn are representatives of a second the ty­pe material was revised, and the misidentifications generation. It is, however, quite unlikely­ that there is were assessed (Nässig & Brech­lin 995, Wu & Naumann a spring generation in these rather well ex­plored areas 2006); the nominal tax­on chapae was fix­ed to the ♂ in northern Vietnam and China from where nominoty­- specimen, now being the lectoty­pe. Its locality­ of origin pical A. chapae is recorded so far. There were so many­ was indicated as “Chapa, (Tonkinesische Hochalpen), ex­peditions and collecting efforts by­ Russian, Vietna- 500 m, Edinger [leg.]”. There were no other details. mese, Japanese and Chinese collectors all y­ear round This place is situated in northern Vietnam, near Chapa that a possible second generation should long have been (= Sa Pa) village, Fan Si Pan (= Fansipan) mountains. found. Also from the long lasting development of the The ♀ specimen earlier included into the ty­pe series of preimaginal instars (Wu & Naumann 2006) this seems to A. chapae was identified as a ♀ of A. rhodopneuma Röber, be improbable. 925 (Nässig & Brech­lin 995). The flight season data were obtained only­ many­ y­ears later by­ the Russian ento- Material and methods mologist Viktor Sinjaev who found A. chapae again at the ty­pe locality­ in November 994, at 2350 m elevation a.s.l. All four ♂♂ of the new subspecies collected were attrac- The first ♀ of this beautiful moth was then among the ted to a mercury­ light trap between 20:00 and 22:00 h at collected specimens. The material was collected during 550 m altitude of the Langbian plateau around Dalat. 994 and the following y­ears, demonstrating the seasonal The weather conditions were ex­treme enough: strong range of imagines of A. chapae between end of October wind and fog, air temperature about 5° C. © Entomologischer Verein Apollo e. V., Frankfurt am Main 72 DNA sequences an ABI 300 automated sequencer (Applied Biosy­stems) without preliminary­ purification. A. chapae DNA sequen- A few moths were investigated regarding molecular mar- ces obtained in this study­ will be submitted to NCBI kers. One Chinese specimen of A. uljanae Brech­lin, 2007 GenBank. The DNA sequences were verified with Chro- (paraty­pe) and a specimen of A. ningpoana C. Felder masPro, aligned and analy­zed by­ mean of MEGA soft- & R. Felder, 862 were taken as ex­amples of accepted ware version 3.0 (Kumar et al. 2004). separate species. Among molecular markers a most popular one in tax­onomic investigations is subunit I of the For the resulting base sequences, see Tab. 2. mitochondrial cy­tochrome ox­idase gene (COI). For more information see the “Barcode of Life” initiative (Hebert Systematic part et al. 2003a, b, Zakh­arov et al. 2007). This marker is sen- Actias chapae bezverkhovi ssp. n. sitive enough to differentiate tax­onomic groups at spe- (Figs. 3, 4, 7–9) cies and subspecies level. At the same time it is almost Holotype ♂ (Fig. 2): S. Vietnam, Langbian plateau, 40 km N insensitive to intra-population variability­. Dalat, 550 m, 9. iv. 2007, leg. Y. Bezverkh­ov, A. Soch­ivko & The DNA of the moths was ex­tracted using DIAtom™ P. Oudovich­enko; will be deposited in the collection of Dr. S. Naumann, Berlin, Germany­ and, eventually­, in the collections DNA Prep kit (Izogen, Moscow). DNA samples were of Museum für Naturkunde der Humboldt-Universität zu obtained from the legs of dried specimens. The primer Berlin, Germany­. pair LCO490 and HCO298 (see Tab. 2) was subse- Paratypes (in total 3 ♂♂, all same data as holoty­pe):  ♂ in quently­ used to amplify­ a 596 bp fragment of the Cy­to- coll. A. Soch­ivko, Moscow, Russia;  ♂ in coll. S. Kovalenko, chrome Ox­idase subunit I gene. The amplification reac- Moscow, Russia;  ♂ in coll. Y. Bezverkh­ov, Moscow, Russia. tions were carried out in the final volume of 25 mkl with Etymology. The subspecies is named after Yuri Alex­eevich 20 pmol of each primer, 0. g of the isolated DNA and Bezverkh­ov, Russian statesman and organizer of current entomological research in Southern Vietnam. with the universal amplification kit GenePak@PCR Core (Izogen, Moscow). The poly­merase chain reaction (PCR) Description and diagnosis was performed using a GeneAmp® PCR Sy­stem 2700 The comparative morphological characters are given in thermal cy­cler (Applied Biosy­stems, USA). PCR ther- Tab. . The morphology­ details of the genitalia were taken mal regime consisted of one cy­cle of  min at 94°C; five from the article of Wu & Naumann (2006) and from our cy­cles of  min at 94°C, .5 min at 45°C and .5 min at own collected material. As no ♀♀ of A. chapae bezverkhovi 72°C; 35 cy­cles of  min at 94°C, .5 min at 50°C and are known, the description deals only­ with ♂♂.  min at 72°C and a final cy­cle of 5 min at 72°C (Folmer et al. 994). The PCR products were identified using The other elements of wing pattern like form and posi- electrophoresis in % agarose gel (Sigma, United States). tion of dark medial band are rather variable and cannot Each PCR product was sequenced in both directions on be used to distinguish the subspecies. Table 1: Comparison of the morphology of the two Actias chapae subspecies. Male specimens A. chapae bezverkhovi A. chapae chapae Character ♂ genitalia: shape of the valves and The valves are less flat and more elongate; the distal The distal margin of the harpe is angular (Figs. 7–9) harpe margin of the harpe is round (Figs. 5–6) The tegumen bears three dorsal processes (Fig. ♂ genitalia: dorsal tegumen 8, lines); in the middle there is a small additional The tegumen bears only­ two processes (Fig. 6, lines) (= 9th tergite) processes process, similar to a small “pseudouncus” Forewing: apex shape The apex­ is slightly­ produced (Fig. 2) The apex­ is round (Fig. ) Being formed by­ black scales, the border is darker Being formed by­ y­ellowish scales, the border is colored Forewing: medial-discal eyespot in comparison with the closest veins; vein D2 ex­ists as dark as the closest veins. The short vein D2 is border (Fig. 4; for ex­planation, see Fig. ) reduced completely­ (Fig. 3; for ex­planation, see Fig. ) Timing of adult generations Spring generation (April) only­ known Autumn generation (October/November) only­ known Table 2: DNA base sequences (see text). DNA Base sequences Primer LCO1490 5‘-GGTCAACAAATCATAAAGATATTGG-3‘ Primer HCO2198 5‘-TAAACTTCAGGGTGACCAAAAAATCA-3‘ TTGGTCCAACCAATCATAAAGATATTGGAACTTTATATTTTATTTTTGGAATTTGATCAGGGATAGTGGGAACTTCTTTA AGCCTTCTTATTCGAGCTGAATTAGGAACTCCAGGTTCTTTAATTGGAGATGATCAAATTTATAACACAATTGTAACAGC Subunit I of TCATGCTTTTATTATAATTTTTTTTATGGTAATACCTATCATAATTGGAGGATTTGGAAATTGATTAATTCCTTTAATACT mitochondrial TGGAGCTCCAGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGATTACTTCCCCCATCTCTTATTCTTTTAATTTCT cytochrome oxidase AGTAGAATTGTAGAAAATGGAGCTGGTACAGGATGAACAGTTTATCCACCTCTTTCTTCTAATATTGCTCATAGAGGAAC gene (COI) of Actias TTCAGTTGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACAACTATT chapae bezverkhovi ATCAATATACGAATAAATAACTTATCATTTGATCAAATACCTTTATTTGTATGAGCAGTTGGAATTACAGCTTTCTTACTC CTTTTATCTCTTCCTGTATTAGCTGGAGC © Entomologischer Verein Apollo e. V., Frankfurt am Main 73 3 ♂ ♀ 1 4 5 6 2 7 8 9 Fig. 1: Male and female of Actias chapae chapae, N. Vietnam, Fansipan Mt. (photo V. Sinjaev). — Fig. 2: Male holotype of Actias chapae bezverkhovi. — Figs. 3–4: Forewing eyespot in ♂♂ of A. chapae: Fig. 3: A. chapae chapae. Fig. 4: A. chapae bezverkhovi (compare Fig. 11). — Figs. 5–9: ♂ genitalia of Actias chapae subspecies. Figs. 5–6: A. chapae chapae; Fig. 5 normal view from ventro-caudal side; Fig. 6 opposite view from dorso-cephal side; lines to show the two dorsal tegumen processes. Figs. 7–9: A. chapae bezverkhovi; Fig. 7 normal view from ventro-caudal side; Fig. 8 opposite view from dorso-cephal side; lines to show the three dorsal tegumen processes; Fig. 9 natural shape without flattening (phallus removed). — Illustrations not to the same scale. © Entomologischer Verein Apollo e. V., Frankfurt am Main 74 Fig. 10: Unrooted linearized similarity tree. Minimal evolution model (SBL = 0.138). Analysis of molecular markers The holoty­pe and a paraty­pe specimen of A. c. bezverkhovi have been screened for mitochondrial COI gene DNA to provide a “genetic passport”. We could not find any­ other records for A. chapae in the public databases like BOLD (BOLD 2008) and NCBI GenBank (NCBI 2008). Both specimens involved in the study­ have, as may­ be ex­pected, shown the same DNA marker sequence, see Fig. 0; the base sequences see in Tab. 2. Two other accepted species have been involved in analy­sis for comparison. The questions concerning molecular phy­logeny­ of Actias will be discussed in forthcoming publications. An unrooted linearized similarity­ tree is shown in Fig. 0. Distribution A. c. bezverkhovi was found in the northern part of the Langbian plateau with a narrow stripe of primary­ moun- 11 tain forests at the elevation 400–2200 m. Fig. 11: Forewing of Actias chapae, with schematic venation to show vein So far, no geobotanical investigation of this area was D2 (N. Ivshin). conducted, and no attempts have been made to find the natural hostplant(s) of A. c. bezverkhovi. Nevertheless, the analy­sis given below may­ help to define directions The third pine species is Pinus kesiya Royle ex­ Gor- for future research. Generally­ it is well known that some don, known as Langbian pine in Vientam. It is consid- Actias species, including the Chinese (from Nanling ered as very­ perspective species for planting and culti- Shan) population of Actias c. chapae, have Pinaceae as vation primarily­ due to the ease of planting and good their hostplants (Renner et al. 2006, Wu & Naumann adaptation. According to Razal et al. (2005), P. kesiya 2006), and the spatial distribution of their populations has very­ wide distribution. In the East it forms forests may­ thus also be delimited by­ hostplant distribution. on the Philippines, within an altitudinal range of 750– According to the review by­ Wang & Hong (200) there 2450 m. In Thailand, P. kesiya is confined to the North- are only­ a few original Vietnamese pine species. west and North, occurring mainly­ in the mountain ranges west and southwest of Chiang Mai to and across The first, Pinus dalatensis de Ferré (Dalat or Vietnamese the border to My­anmar. Isolated occurrences are found white pine), has a very­ restricted range in evergreen sub- to the northwest of Maung Nan in the northern moun- tropical forests of Vietnam at elevations above 500 m. tains, on the Phu Kradung plateau near Loei, and the Often it occurs in mix­ed stands being very­ sparsely­ most southerly­ location in Thailand is in the Mieng distrubuted; the species’ survival appears to be threa- Hills. The pine forms here the forests between 000 and tened. 500 m, with the range of altitudinal distribution from The second, Pinus fenzeliana Hand.-Mzt. (Hainan white 300–800 m, although rarely­ below 800 m. In Vietnam, pine), is common in South China in Hainan, Guangx­i P. kesiya occurs in the Annam Cordillera mountain and Guizhou provinces as well as in central Vietnam at chain, which is in southern Vietnam. The best and most elevations of 000–600 m. ex­tensive stands are in the Langbian plateau near Dalat, © Entomologischer Verein Apollo e. V., Frankfurt am Main 75 at a mean altitude of about 500 m, although the species Hebert, P. D. N., Cywinska, A., Ball, S. L., & Dewaard, J. R. grows within the altitudinal range of 300–2300 m on (2003a): Biological identifications through DNA barcodes. — Proceedings of the Roy­al Society­ of London, series B, Bio- Langbian. Other locations in Vietnam are in the Haut logcal Sciences, London, 270: 33–32. Donnai plateau southeast of Dalat in the forest of Yankar, ———, Ratsingh­am, S., & Dewaard, J. R. (2003b): Barcoding animal at Tourland To, and at P’sore north of Kinda. Small stands life: Cy­tochrome c ox­idase subunit  divergences among have also been reported on the southern mountains of closely­ related species. — Proceedings of the Roy­al Society­ Langbian, and also scattered in the semi-arid zones of of London, series B, Biologcal Sciences, London, 270: 596– the North, and further up in the highlands close to the 599. border with China. Kumar, S., Tamura, K., & Nei, M. (2004): MEGA 3: Integrated software for molecular evolutionary­ genetics analy­sis and At lower elevations up to 000 m occur Pinus merkusii sequence alignment. — Briefings in Bioinformatics, Ox­ford, Jungh­ & De Vriese and Pinus massoniana Lamb. (Gold- 5: 50–63. ammer 992). They­ form the forests covering the area of Mell, R. (950): Aus der Biologie der chinesischen Actias Leach­ 35 000 ha which are highly­ endangered by­ overlogging (Argema chapae sp. n., A. sinensis f. virescens f. n.). — Ento- due to illegal logging, ex­panding shifting agriculture, mologische Zeitschrift, Frankfurt am Main, 60 (6): 4–45, grazing practices, and increasing demands for fuelwood (7): 53–56. and charcoal production. P. merkusii is considered as one Morish­ita, K., & Kish­ida, Y. (2000): Moths of Nanling mountains, of the few truly­ tropical pine species, occurring naturally­ Guangdong, S. China. — Yadoriga, Toky­o, 187: 0–7, pls. –4 [in Japanese]. in Southeast Asia including My­anmar, Thailand, Laos, Nässig, W. A., & Brech­lin, R. (995): Designation of the lectoty­pe Vietnam, Cambodia, Sumatra in Indonesia, and in the of Actias chapae Mell, 950 (Lepidoptera: Saturniidae). — islands of Luzon and Mindoro in the Philippines. Either Nachrichten des Entomologischen Vereins Apollo, Frankfurt pure or mix­ed plantations of P. kesiya with P. merkusii am Main, N.F. 16 (2/3): 309–30. and P. massoniana are reported to have been established Razal, R. A., Tolentino, E. L. T. jr., Carandang, W. M., Ngh­ia, in Vietnam. N. H., Hao P. S. & Luoma-Ah­o, T. (2005): Status of genetic resources of Pinus merkusii (Jungh­ & De Vriese) and Pinus Thus, it is to be ex­pected that the natural hostplant of kesiya (Royle ex­ Gordon) in Southeast Asia. — Los Baños, A. chapae bezverkhovi may­ be found among these 5 pine Philippines (UPLBCFNR), Malay­sia (IPGRI-APO); 33 pp. tree species. Renner, F., Prange, R., Plontke, R., & Nässig, W. A. (2006): Die Zucht des Hy­briden Actias sinensis (Walker, 855) Männ- Acknowledgments chen × A. dubernardi (Oberth­ür, 897) Weibchen (Lepido- ptera: Saturniidae). — Nachrichten des Entomologischen Ver- The authors would like to ex­press their gratitude to eins Apollo, Frankfurt am Main, N.F. 27 (/2): 29–52. the following persons: our colleagues Pavel Oudovi- Wang H. & Hong J. (200): Genetic resources, tree improvement ch­enko and Yuri Bezverkh­ov for invaluable help and and gene conservation of five-needle pines in East Asia. assistance in all stages of current research; Viktor Sin- — IUFRO Working Party­ 2.02.5. International Conference, jaev for important information concerning biology­ and Medford, Oregon, USA (July­ 23–27, 200): 73–78. behaviour of A. c. chapae, for loan of material, rare pub- Wu Y. & Naumann, S. (2006): The preimaginal instars of Actias cha­ pae (Mell, 950) (Lepidoptera: Saturniidae). — Nachrichten lications and providing photographs of ty­pe specimens; des Entomologischen Vereins Apollo, Frankfurt am Main, Professor Dr. Ilia Zakh­arov and Dr. Elena Sh­aikevich­ for N.F. 27 (/2): 7–2. advising in genetic research and providing laboratory­ Zakh­arov, I. A., Sh­aikevich­, E. V., & Ivsh­in, N. V. (2007): The facilities. Further Dr. Stefan Naumann for loan of mate- Barcode of Life and butterflies identification. — Priroda rial and critical comments on the manuscript. (“Nature”, Russia), Moscow, 9: –5. References Internet references Folmer, O., Black, M., Hoeh­, W., Lutz, R., & Vrijenh­oek, R. (994): BOLD (2008): Barcode of Life data sy­stems. — www.boldsy­stems. DNA primers for amplification of mitochondrial cy­to- org/views/login.php (last accessed: 5. iv. 2008). chrome-c ox­idase subunit I from diverse metazoan invert- NCBI (2008): National Center for Biotechnology­ Information ebrates. — Molecular Marine Biology­ and Biotechnology­, (GenBank). — www.ncbi.nlm.nih.gov (last accessed: 5. iv. New York, 3: 294–299. 2008). Goldammer, J. G. (992): A fire problem analy­sis. — International Forest Fire News, New York, Geneva, 7: 3–6. Received: 3. iv. 2008 © Entomologischer Verein Apollo e. V., Frankfurt am Main, August 2008 ISSN 0723-992 © Entomologischer Verein Apollo e. V., Frankfurt am Main

See more

The list of books you might like