Logout succeed
Logout succeed. See you again!

1 transcription factor redundancy ensures induction of the antiviral state PDF
Preview 1 transcription factor redundancy ensures induction of the antiviral state
JBC Papers in Press. Published on October 13, 2010 as Manuscript M110.165936 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M110.165936 TRANSCRIPTION FACTOR REDUNDANCY ENSURES INDUCTION OF THE ANTIVIRAL STATE Sonja Schmid1, Markus Mordstein2, Georg Kochs2, Adolfo García-Sastre1,3,4, and Benjamin R. tenOever1,3 1. Department of Microbiology, Mount Sinai School of Medicine, New York, New York 10029, USA. 2. Department of Virology, University of Freiburg, Hermann-Herder-Strasse 11, D-79104 Freiburg, Germany.3. Global Health and Emerging Pathogens Institute. 4. Department of Medicine, Division of Infectious Diseases, Mount Sinai School of Medicine, New York, New York 10029, USA. Address correspondence to: Benjamin R. tenOever, Mount Sinai School of Medicine, One Gustave L Levy Place, Department of Microbiology, Box 1124, New York, NY 10029, Tel: 212.241.7849, Fax: 212.534.1684, E-mail: [email protected] The transcriptional response to virus infection stimulated response element (ISRE) (5,8-12). As is thought to be predominantly induced by no crystal structure of ISGF3 has been solved, the interferon (IFN) signaling. Here we exact DNA binding contacts or even the demonstrate that, in the absence of IFN stoichiometry of the ISGF3 complex remains signaling, an IFN-like transcriptome is still unclear. Based on the structures of STAT1 and maintained. This transcriptional activity is IRF dimers, models for ISGF3 have been proposed mediated from IFN-stimulated response in which the major and minor grooves of the ISRE elements (ISREs) that bind to both the IFN are occupied by the DNA binding domains of stimulated gene factor 3 (ISGF3) as well as to IRF9 and STAT1 on respective sides of the DNA IFN response factor 7 (IRF7). Through a (13). In this model, STAT1 interacts with the D o w combination of both in vitro biochemistry and hydrogen : donor : acceptor : acceptor (HDAA) n lo in vivo transcriptional profiling, we have groups and three repetitive methyl : acceptor : ad e dissected what constitutes IRF-specific, ISGF3- donor : acceptor (MADA) groups provided in the d fro specific, or universal ISREs. Taken together, major groove of CTTT base pairing, in addition to m h the data presented here suggests that IRF7 can the neighboring acceptor : hydrogen : acceptor ttp induce an IFN-like transcriptome in the (ADA) groups associated with the minor groove of ://w w absence of type-I or -III signaling and therefore A:T or T:A base pairing. The opposing minor w provides a level of redundancy to cells to ensure groove of CTTT (providing AHA, ADA, ADA, .jbc .o the induction of the antiviral state. and ADA contacts respectively) is occupied by rg The type I interferon (IFN-I) family is a subset of IRF9 as well as the major groove of the A and T by/ g cytokines encoded by a single IFNβ gene and a downstream base pairing (14-16). In contrast, ue s tandem cluster of IFNα genes (1). The binding of homo- and hetero-dimeric complexes of t on transcriptional induction of IFN-I is limited to STAT1 and/or STAT2 is limited to inverted De c virus-infected cells and leads to the expression of a repeats in which HDAA contacts are required in em b multitude of genes, conferring antiviral and consecutive major grooves, encoded by motifs er 2 immunostimulatory functions (2,3). Binding of termed IFNγ activated sequences (GAS) (17,18). 7, 2 IFNα and/or IFNβ to the type I IFN receptor The sequence of the ISGF3-binding site partially 01 8 (IFNAR) leads to phosphorylation of the signal overlaps with the IRF binding element (IRF-E): transducer and activator of transcription 1 AANNGAAANNGAAA (14,19). This sequence is (STAT1) and STAT2 (4), which assemble together recognized by the IRF family of transcription with interferon regulatory factor 9 (IRF9) into a factors, comprising IRF1 to IRF9 and virus- multisubunit complex commonly referred to as encoded analogues of cellular IRFs (20). The IFN-stimulated gene factor 3 (ISGF3) (5). Aside crystal structure of different IRFs bound to a DNA from IFN-I, ISGF3 is activated by type III IFN target sequence demonstrated that a dimeric IRF (IFN-III), IFNλ1-3, an activity mediated by a binds to two overlapping stretches of different cellular receptor (6,7). ISGF3 AANNGAAA, with the two IRF molecules translocates to the nucleus and binds to the occupying opposite sites of the DNA double-helix, enhancers of more than one hundred IFN-I making minor groove contacts (AHA) with the stimulated genes (ISGs) whose timely expression first two A bases, and major groove contacts confers a cellular environment non-conducive to (AADH, ADAM, ADAM, ADAM) with the viral replication. The motif responsible for ISGF3 GAAA sequence (14,15,21,22). However, each binding is composed of the sequence: family member performs its specific role in GAAANNGAAACT, and is referred to as an IFN- biological processes through distinct expression 1 Copyright 2010 by The American Society for Biochemistry and Molecular Biology, Inc. patterns and slightly different DNA binding IRF7. To address this question, we systematically specificities within the broad IRF consensus compared binding of IRF7 and ISGF3 to a variety sequence (21,23-29). While IRF9 is an integral of ISRE motifs encoded upstream of the component of ISGF3 and is essential in mediating transcriptional start sites of those “ISGs” induced IFN-induced transcriptional activity, two in the absence of IFN signaling. Here we additional members, namely IRF3 and IRF7, demonstrate that IRF7 and ISGF3 can engage function independently and are responsible for the identical DNA motifs and also define the induction of IFN (30,31). Upon cellular infection, properties that confer IRF7- and/or ISGF3- IRF3 and IRF7 are phosphorylated by nuclear specificity. Furthermore, we define the IRF7 factor κB kinase (IKK)-related kinase IKKε (also transcriptome in the absence of IFN-I and IFN-III called IKK-i) or TANK-binding kinase 1 (TBK1) signaling. Taken together, we find a significant (32), form hetero- and homo-dimers, translocate to overlap between the genes induced by IRF7 and the nucleus and transcribe IFNβ and the various ISGF3 suggesting that transcription factor IFNα genes (33). Whereas IRF3 is ubiquitously redundancy evolved to ensure the induction of the expressed (34), basal IRF7 expression is limited to antiviral state. hematopoietic cells, with the highest expression level in plasmacytoid dendritic cells (pDCs) (35). EXPERIMENTAL PROCEDURES D Other cell types upregulate IRF7 upon stimulation Virus- We used the recombinant influenza A virus ow n with IFN-I/-III and/or tumor necrosis factor α strains SC35M wild type (SC35M-wt), SC35M- lo a (TNFα) (36,37). Regardless of cell type, ΔNS1 (44), deficient in the nonstructural protein 1 ded phosphorylation and activation of IRF3 and IRF7 (NS1), and PR/8/34 NS1-R38AK41A (45), fro m results in nuclear localization and binding to IRF- harboring two amino acid substitutions in NS1. h Epr osmitiessc,u iwtyi thw itIhR Fre7g asrhdosw toin gIR Fsi-gEn ivfiacraianttiloyn m(3o0r)e. -MILic2e8 Ranαd-/- vmiraicle i n(4fe3c)t,i ocnasr-r yBin6g.A i2nGta-cMt xM1-xI1F NaAlleRl1e-s/- ttp://ww w The IRF3-specific transcriptome that results and defective alleles for IFNAR1 and IL28Rα were .jb following IRF3 activation has been determined bred locally, in accordance with institution animal c.o and compromises a small subset of genes, most care guidelines. Mice were anesthetized by brg/ y notably IFNβ (38-41). In addition, similar studies intraperitoneal injection of a mixture of ketamine g u focusing on the transcriptional potential of IRF7 (100µg per gram body weight) and xylazine (5µg est o have also been performed and yielded similar per gram body weight) before intranasal infection n D results, albeit demonstrating a greater diversity of with 105 plaque forming units (pfu) of either ec e genes mediated by both autocrine IFN-I signaling SC35M-wt or SC35M-ΔNS1 in 50µl PBS mb e and the greater binding capacity of IRF7 (42). containing 0.3% BSA. Animals treated with r 2 7 Taken together, it is widely accepted that IRF3 PBS/0.3% BSA served as negative controls. , 2 0 and IRF7 are essential components required for Cell culture and reagents- HEK293T, 2FTGH, 18 the establishment of the antiviral state, with their U3A (46), and A549 cells were cultured in primary function residing in the activation of Dulbecco’s modified eagle medium (DMEM, ISGF3 through the synthesis of IFN-I and/or IFN- Gibco) supplemented with 10% fetal bovine serum III. (FBS) and 1% penicillin/ streptomycin. Primary In an effort to determine the in vivo contribution of murine embryonic fibroblasts (MEFs) were IFN-I/-III to the antiviral response, we performed derived from pools of Irf3-/-, Irf7-/-, or Irf3-/-Irf7-/- influenza A virus infections in mice encoding knockout mice and were a kind gift of Michael S. genetic disruptions in the receptors for both IFN-I Diamond (Washington University School of and –III signaling (43). Surprisingly, Medicine). Primary MEFs were also cultured in transcriptional profiling of infected lung tissue DMEM supplemented with 10% FBS and 1% revealed that a significant portion of virus-induced penicillin/streptomycin. Transfection of DNA was genes were “interferon-stimulated genes” despite performed with Lipofectamine 2000 (invitrogen). the complete absence of ISGF3 activation. Given siRNA against human IRF3 (Santa Cruz) was this intriguing discovery, we sought to determine transfected at a final concentration of 50nM in the functional redundancy between the Opti-MEM I reduced serum medium (invitrogen), transcriptomes of ISGF3 and IRFs, most notably using Lipofectamine RNAiMAX (invitrogen) 2 according to the manufacturers’ instructions. 1µg of antibody, specific to STAT1α p91 (C-111), Where indicated, cells were treated with 15-30 STAT2 (H-190), ISGF3γ p48 (H-143), IRF3 (FL- IU/ml of human IFNβ (BEI resources). For 425), IRF7 (G-8) (all purchased from Santa Cruz), inhibition of translation, primary MEFs were Flag (M2, Sigma) or control IgG was used. treated with 100µg/ml of cycloheximide (Sigma). Western blot analysis- Western blot analysis was 1x106 primary MEFs or 3x106 A549 cells were performed as previously described (49). transfected with 4µg or 24µg respectively of Antibodies specific to beta-actin (Abcam), Flag poly(I:C) (Sigma) using Lipofectamine 2000. (M2), STAT1α p91 (C-111), IRF3 (FL-425), and Infection of cells with PR/8/34 NS1-R38AK41A, IRF7 (G-8, Santa Cruz) were all used at a was performed at a multiplicity of infection (MOI) concentration of 1 µg/ml and antibodies specific to of 5 in complete medium. ISG56 (Thermo Scientific) and MxA were used at Plasmids- Mammalian expression plasmids a 1:1000 dilution. encoding flag-tagged human IRF3, IRF7, IRF9, Quantitative PCR (qPCR)- qPCR was performed STAT1, and STAT2 were generated using the as previously described (49). Primers used for multiple cloning site (MCS) of the pCAGGS qPCR can be found in Table S1. plasmid (47). An expression plasmid for flag- Affymetrix analysis- Both affymetrix analyses tagged human IKKε was generated by inserting were performed at the biopolymers facility at D the open reading frame (ORF) of IKKε into MCS Harvard medical school o w n of pFlag-CMV2 (Sigma). The reporter construct (http://genome.med.harvard.edu/) and data was lo a encoding for firefly luciferase under control of the analyzed on the gene pattern server de d human ISG15-ISRE was constructed, by inserting (http://genepattern.broadinstitute.org). Lungs from fro m an annealed oligonucleotide harboring the ISG15- infected and mock treated mice were harvested at h ISRE sequence (forward: 5’ AGCTTCTCGGGAA the indicated time-points and total RNA was ttp AGGGAAACCGAAACTGAAGC 3’; reverse: 5’ isolated. RNA from three lungs per cohort was ://ww w TCGAGCTTCAGTTTCGGTTTCCCTTTCCCG pooled to perform standard affymetrix analysis. .jb AGA 3’) into the MCS of pLuc-MCS (Stratagene). The heat map depicts a subset of genes that were c.o To generate cells stably expressing GFP, IRF7, or induced in Flu-ΔNS1-infected samples at least brg/ y STAT1 a lentiviral vector was used. The three times over mock-treated samples. For g u respective ORFs were inserted into a minimal analysis of IRF7-driven genes in U3A cells, U3A es t o HIV-1 provirus termed V1 (48) via the restriction cells were transfected with expression plasmids n D enzyme SfiI. encoding for Flag-tagged IRF7 and Flag-tagged ec e Luciferase assay- 2x105 HEK293T cells were IKKε in a ratio of 1:1. Control U3A cells were m b e transfected with 0.1µg per expression plasmid transfected with a GFP-encoding plasmid. 4hpt, r 2 7 together with 0.2µg of the ISG15-ISRE dependent medium was changed and 25 IU/ml of type I IFN , 2 0 luciferase construct and 10ng of a construct was added. Total RNA was isolated 20hpt. 18 constitutively expressing Renilla luciferase to Standard affymetrix analysis was performed in normalize for transfection efficiency. Empty replicates on U133A 2.0 affymetrix chips. Genes, vector served to fill up each transfection reaction significantly (p < 0.05) upregulated at least 2-fold to 0.6µg of total plasmid. 14 hrs post transfection in samples transfected with IRF7 and IKKε are (hpt) medium was changed and 15 IU/ml of IFNβ shown in the heat map. ISGs were identified with was added. Luciferase activity was determined the database of http://www.interferome.org. 24hpt using the dual-luciferase reporter assay RESULTS system (Promega). Profiling virus-induced genes in the absence of Electrophoretic mobility shift assay (EMSA)- IFN-I and –III signaling. Cells detect invading 2x106 HEK293T cells were transfected with 1µg viruses by recognizing pathogen-associated per expression plasmid and empty vector served to molecular patterns (PAMPs) with specific fill up each transfection reaction to 4µg of total receptors, leading to activation of several signaling plasmid. 14hpt medium was changed and 15 IU/ml pathways ultimately resulting in the induction of of IFNβ was added. Whole cell extracts were IFN-I and -III. Autocrine and paracrine signaling obtained 24hpt and EMSAs were performed as of IFNs in response to PAMP detection results in described previously (13). For supershift analysis, the upregulation of ~100 antiviral genes, 3 generating a cellular environment non-conducive within their respective DNA binding motifs, we to productive virus infection. To identify virus- speculated that IRF7 may perform functionally inducible, IFN-independent genes, we treated redundant roles to ISGF3. IRF7, unlike IRF3, is knockout mice, deficient for both functional type I more promiscuous in its DNA binding (30), is and III IFN receptors (IFNAR1-/-IL28Rα-/-) with inducible by IFN (36), and is found at high basal recombinant influenza A virus strains which where concentrations only in critical viral response cells either wild type (Flu-wt) or lacked the IFN- such as pDCs (35,52). To address this question, antagonistic viral product NS1 (Flu-ΔNS1) we aimed to identify an ISRE that could be bound (43,50,51). 12, 24, and 48 hrs post infection (hpi), by both ISGF3 and IRF7 with relative equal lungs of infected and uninfected mice were affinities. For these purposes, we focused on the harvested and total RNA was isolated. As manipulation of a well-characterized ISRE motif expected, lungs from Flu-ΔNS1 infected mice from the IFN-stimulated gene 15 (ISG15) demonstrated strong transcriptional induction of (40,41,53). To this end, IRF7 or the components of IFNβ and IFNλ2 mRNA after 24 and 48 hpi as ISGF3 (STAT1, STAT2, IRF9) were exogenously compared to Flu-wt infections (figure 1A). produced in fibroblasts and activated with either Transcriptional induction of IFN was not the result IKKε or IFNβ (figure 2A). To check functionality of differences in viral load as levels of of the exogenous proteins, we performed a D nucleoprotein (NP) mRNA were comparable at reporter assay utilizing an ISG15 ISRE-dependent ow n each time point analyzed between both viral luciferase construct. Expression of IRF7 or lo a cohorts (figure 1A). RNA derived from pooled ISGF3, in the absence of stimulation, did not result de d lungs of ΔNS1 infected mice were extracted and in significant activation, however, activation of fro m analyzed by affymetrix-based microarray. Figure IRF7 with IKKε or ISGF3 with either IKKε or h f1oBld d epinic tsI FaN sAubRs1et-/ -oILf 2g8enReαs- /u- prmegicuel atiendf eact tleeda,s t a3s- I2FBN).β Tlehdis t oac stitvroitnyg c oinrdreulcattieodn too ft hlue ceinfegraagseem (feingtu oref ttp://ww w compared to uninfected, mice. Of note, other an ISG15 ISRE oligonucleotide as measured by .jb ISGs such as Mx1 were not upregulated under electro-mobility shift assay (EMSA) (figure 2C). c.o rg these conditions. Subsequent validation of the IRF7 bound to the ISG15 ISRE as a homo-dimer, b/ y array was confirmed by qPCR (figure 1C). but not as a hetero-dimer with IRF3, as only an g u Given the activation of IRF3/7 in response to an antibody generated against the Flag-tagged IRF7, es t o NS1-deficient influenza A virus infection (50), but not against IRF3, could modulate the n D transcriptional induction, in the absence of IFN migration of the complex (figure 2C). ISGF3 ec e signaling, presumably reflects the activity of these migration was impacted by antibodies against mb e transcription factors. This is supported by the STAT1, STAT2, and IRF9, confirming formation r 2 7 observation that IFNβ is highly induced in of a functional ISGF3 complex (figure 2C). , 2 0 response to Flu-ΔNS1, a gene requiring the Furthermore, IRF9-binding to the oligonucleotide 18 cooperative binding of two heterodimeric could be easily detected by EMSA, presumably as IRF3/IRF7 complexes (21). It however is a monomer based on molecular mass, even in the surprising that, in addition to IFNβ, many virus- absence of IFN treatment (figure 2C). Monomeric inducible genes have also been characterized as IRF9 binding is inversely correlated to the ISGs (marked in green in figure 1B) despite the assembly of ISGF3 in which the additional complete loss of ISGF3 activity. These results binding of STAT1 and STAT2 is greatest in the suggest that the paradigm of antiviral signaling presence of IFNβ and IKKε as previously being the transcriptional consequence of IFN- described (13). Taken together, these data mediated ISGF3 activation is incorrect and that a demonstrate that the exogenous expression and layer of redundancy exists to induce a similar activation of IRF7 and ISGF3 reconstitutes a valid transcriptome, presumably to aid in the model to study binding redundancies between intracellular combat against viral infection. these transcription factors. Defining sequence requirements for IRF-specific, To ascertain the requirements for IRF7 and ISGF3 ISGF3-specific or universal ISREs. As the binding, we performed EMSAs on the predicted protein:DNA contacts occupied by aforementioned IRF7 and ISGF3 extracts IRF3/7 and ISGF3 share many common bases beginning first with the wild type ISG15 ISRE 4 (ISG15wt, figure 3A). This ISRE element to -3 position demonstrated that while a variety of corresponds with the enhancer used in the bases were amenable for ISGF3 binding, a T at the luciferase reporter shown in figure 2B. The -1 position, an A at the -2 position, or a C or G at ISG15-ISRE consists of two overlapping ISRE the -3 position significantly limited ISGF3 binding core-sequences as defined by the GAAA motif strongly suggesting that ISGF3 binds the major found in characterized ISRE and IRF-E sites groove at this location (figure 3E-I and (figure 3A, blue box). Surprisingly, while the supplemental figure 2). ISG15 ISRE encodes a complete ISGF3 We next analyzed the nt contribution of the ISRE (GAAANNGAAACT (5) and IRF motif core as it relates to the binding of IRF7 and (AANNGAAANNGAAA (14)) the probe itself ISGF3. To execute these studies, we was found to only strongly associate with IRF7. systematically replaced each of the core nts with To further refine the binding sites of IRF7 and T’s and ascertained the impact these substitutions ISGF3, and to ascertain whether overlap between had on IRF7 and ISGF3 binding (figure 3I-L and the transcription factor motifs is evident, we began supplemental figure 3). Figure 3I-L shows four by minimizing the ISG15 ISRE to a single core examples of nts that define IRF7 and/or ISGF3- sequence flanked with adjacent nucleotides (nts) specificity. Some mutations, like ISG15core2T from the human ISG15-promoter (grey boxes in (figure 3I) did not affect IRF7 or IRF9 binding, D figure 3B, ISG15core+wt in which the core is but reduced binding of ISGF3. Thus, showing nts o w n referenced as nts 1 to 12, the 5’ flanking sequence that make contact to STAT1. Furthermore, some lo a -1 to -7 and the 3’ flanking region +1 to +8). mutations such as position 3, abolish binding of de d Motif minimization resulted in minimal reduction IRF7 and ISGF3 but have only a moderate affect fro m of IRF7 binding but a significant increase in the on IRF9-binding (figure 3J). Mutation of position h binding of ISGF3 and IRF9 (figure 3B). 7 completely abolishes IRF7-binding, reduces ttp Interestingly, randomizing the flanking sequences IRF9-binding, but does not affect ISGF3 (figure ://ww w of the minimal motif (red boxes in figure 3C, 3K). Last, mutation of position 10 abolishes IRF7 .jb ISG15core+5’_3’random) did not affect IRF7 binding and IRF9-binding, but maintains a weak c.o but abolished ISGF3 and IRF9 binding further association with ISGF3 (figure 3L). brg/ y supporting the notion that there are IRF7-specific Taken together, this mutational analysis suggests g u sequences and confirming that an ISGF3 ISRE has an IRF7-binding consensus is encoded by the es t o sequence requirements that extend beyond the sequence AAWNCGAAA (W = A/T), which n D consensus motif (figure 3C). Changing the 3’- differs slightly from the published sequence ec e flanking sequence back to wt (figure 3D, AANNGAAANNGAAA. To ascertain the m b e ISG15core+5’random) did rescue limited binding of importance of the first two bases at the -2 and -3 r 2 7 ISGF3 and IRF9 as compared to position, we replaced both bases in ISG15core+wt , 2 0 ISG15core+5’_3’random, but it failed to reach the with As and found no impact on IRF7 binding, in 18 binding capacity observed for ISG15core+wt. Not contrast to ISGF3 (figure 3M). Taken together surprising, IRF7-binding was not affected by the with the results of figure 2A-H, it would appear 3’-flanking sequence (figure 3D). that IRF7 binds the minor groove at this position, To delineate the sequence requirements for ISGF3 making contact only at the -3 position. We next further, we maintained the endogenous 3’ flanking investigated whether nts at position -2 and -3 sequence and partially restored the 5’-adjacent nts influenced IRF7-binding in the context of an ATC to TCG (ISG15core+5’TCG, figure 3E) to unfavorable ISRE-core. We therefore changed the determine what effect this would have on the C at position 7, previously found to be critical for binding of ISGF3. While binding of IRF7 or IRF9 IRF7 binding (figure 3K), and combined this with was not affected when comparing ISG15core+wt to the predefined optimal AA- or TT-nts at positions ISG15core+5’TCG, the affinity of ISGF3 to this -2 and -3 (figure 3N). Interestingly, this probe motif was still lower than to ISG15core+wt but analysis demonstrated that optimal binding in the increased as compared to ISG15core+5’random. In minor groove at positions -2 and -3 can contrast, changing the remaining 4 nts of the 5’ compensate for sub-optimal binding in the major flanking sequence did not impact ISGF3 binding groove at position 7. (supplemental figure 1). Further analysis of the -1 5 Finally, we determined which nts in the 3’- dependent of IFN and not directly responsive to flanking region are important for ISGF3 binding. IRFs (54) (figure 4B). Mutation of the 3’-flanking sequence reduced To ascertain the IRF7 transcriptome in the absence binding of ISGF3 compared to the wild type of IFN signaling, exogenous expression of GFP ISG15 probe (figure 3O). This loss of binding was was compared to expression of IRF7 and IKKε by likely the result of a loss of IRF9 binding as the standard affymetrix gene array (figure 4C). IFNβ randomized 3’-flanking sequence also inhibited was also added to both conditions to eliminate any IRF9 engagement (figure 3O). This is supported non-canonical signaling induced by IFNβ- by the fact that reversion of position +1 to a T, mediated, STAT1 independent signaling. Not rescued IRF9 binding and increased ISGF3 surprisingly, gene array analysis of IRF7 and affinity for the ISRE (figure 3P). Binding analysis IKKε expressing cells demonstrated the induction for IRF3 on all of these probes demonstrated only of previously characterized IRF3-regulated genes, moderate stimulus-specific binding on ISG15wt, namely the members of the IFN-inducible p56 OSG15core+AA, and ISG15core7T+TT in agreement family (IFN-induced protein with tetratricopeptide with past studies regarding IRF3 binding repeats 1 IFIT1/ISG56, IFIT2/ISG54, and requirements (26,30). IFIT3/ISG60) (39-41), and radical S-adenosyl In summary, this body of work demonstrates that methionine domain containing 2 (RSAD2) (41). D an ISRE can demonstrate both, transcription factor However, in addition to this subset, IRF7 o w n specificity or redundancy. Furthermore, IRF7 and activation resulted in cytokine induction lo a ISGF3, both multimeric protein complexes, show (including IFN-I, as previously described de d plasticity in the DNA contacts they require for (25,26,31,52), as well as a large subset of genes fro m stable occupancy. Taken together, these data previously thought to be dependent on IFN-I h suggest that the minimal DNA-binding motif of signaling (figure 4C, ISGs marked in green). ttp IRF7 is AAWNCGAAA, but These genes include IFIT5, IFN-induced with ://ww w WWNNGAAANNGAAA can also confer IRF7 helicase C domain 1 (IFIH1), guanylate binding .jb binding compatibility. The detailed consensus of protein IFN-inducible 1 (GBP1), 2’-5’- c.o ISGF3 is WBVGGAAANNGAAACT (B = oligoadenylate synthetase 2 (OAS2), OAS-like brg/ y C/G/T, V = A/C/G). While only changes at the (OASL), and IRF9 in addition to those listed g u underlined nts completely abolish ISGF3 binding (figure 4C). In fact, taken together, ~80% of the es t o on this consensus, single changes at other sites genes upregulated by IRF3/7 in U3A cells were n D were found to reduce overall binding. also upregulated in mice upon infection with Flu- ec e Defining the IRF7-transcriptome in the absence of ΔNS1 (as shown in figure 1B) suggesting that the m b e IFN-I and –III signaling. In an effort to determine functional redundancy between IRF3/7 and ISGF3 r 2 7 whether the ISRE redundancy observed in vivo in is evolutionary conserved amongst vertebrates. , 2 0 IFNAR1-/-IL28Rα-/- double knockout mice and in IRF7-specific, ISGF3-specific and universal ISREs 18 vitro by EMSA could be correlated to in vivo IRF7 in the promoters of ISGs. To confirm the IRF7 activity, we performed an additional microarray in and ISGF3 transcriptomes, U3A cells stably human cells which were also deficient in IFN- expressing GFP (U3A-GFP), IRF7 (U3A-IRF7) or signaling. To this end, we utilized the 2FTGH- STAT1 (U3A-STAT1) were treated with IFNβ or derived human fibrosarcoma cell line U3A, which infected with an influenza A strain, harboring a is deficient in STAT1 and, consequently IFN-I and mutation in NS1 that renders NS1 incapable of IFN-III signaling (figure 4A and B (46). To preventing activation of IRF3/IRF7 (Flu-NS1mut) determine whether activation of IRF7 (45) (figure 5A). Western blot analysis demonstrated the same extensive overlap with demonstrated IRF3-dependent induction of ISG56 ISGF3 observed in vitro, we exogenously in U3A-GFP cells upon virus infection, a response expressed IRF7 or IRF7 and IKKε. As expected, that was further enhanced in U3A-IRF7 cells. IKKε-mediated activation of IRF7 in U3A cells Furthermore, reconstitution of STAT1 in U3A resulted in robust ISRE binding and expression of cells restored IFN-responsiveness of ISG56, also IFNα1 without subsequent synthesis of IFN- demonstrating an enhancement following virus dependent MxA, which is an ISG known to be infection as compared to U3A-GFP control cells. To corroborate the redundancy of the IFN- and 6 IRF-mediated transcriptomes in this model system, To ascertain whether the optimal DNA-binding total RNA from IFNβ or virus treated samples was sequence for IRF7 accurately accounted for the isolated and analyzed by qPCR. As we found IRF7-induced transcriptome, we analyzed the virus replication levels to be comparable at 10 hpi, genomic sequence upstream of the IRF7- we profiled IRF7-dependent genes and compared dependent transcriptional start sites. In support of these to MxA, a hallmark for ISGs (figure 5B). the biochemical studies, we were able to divide the These data demonstrated that MxA was induced in identified genes into two distinct categories: one U3A-STAT1 cells upon IFNβ-treatment alone and subset that contained the sequence further upregulated in infected U3A-STAT1 cells, WWNNGAAANNGAAA (table 1) and another presumably due to a synergistic cooperation which lacked A/T base pairing in the minor groove between ISGF3 and another virus activated factor of position -2 and -3 (marked in italics in table 1). (figure 5B). In contrast, OAS1, which is strongly The promoters of this latter group conformed to induced in U3A-STAT1 cells upon IFNβ the sequence AAWNCGAAA. In contrast, the treatment, was also induced in virus infected U3A- ISRE of MxA does not conform to the required IRF7 cells. In addition, knock-down of minor groove consensus at the -2 and -3 positions, endogenous IRF3 in U3A-IRF7 cells did not nor does it encode a C in between the two GAAA significantly reduce induction of OAS1 repeats. D (supplemental figure 4). These results suggest that To test binding of IRF3, IRF7, and ISGF3 to the o w n OAS1 is predominantly regulated by ISGF3 and ISREs of IRF7-regulated genes, we exogenously lo a IRF7, but not by the ubiquitous IRF3. expressed each of the three transcription factor de d Furthermore, induction of ISG56 in U3A-STAT1 complexes independently and analyzed the fro m cells in response to IFNβ is low, compared to its putative ISREs by EMSA. As expected, the MxA- h induction by viral infection, suggesting that IRF3 ISRE bound ISGF3 but not IRF3 or IRF7 (figure 6 ttp and IRF7 are stronger inducers of ISG56 than and supplemental figure 5). In contrast, IRF7 and ://ww w ISGF3. Lastly, CXCL10, MAP3K8, and IFNα1 ISGF3, but not IRF3, bound to the OAS1-ISRE. .jb are not expressed upon IFNβ-treatment, but all The ISG15-ISRE is a more promiscuous ISRE, c.o demonstrate robust induction in U3A-IRF7 cells. binding IRF3, IRF7, and ISGF3, whereas only brg/ y In addition, knock-down of endogenous IRF3 IRF7 demonstrated strong binding to the g u suggested, that IRF7 can efficiently drive CXCL10-ISRE. Although IRF3/7 heterodimer es t o transcription of CXCL10, MAP3K8, and IFNα1 in formation cannot be ruled out, analysis of IRF3 n D the absence of IRF3 (supplemental figure 4). To knock-down and Irf3-/- primary MEFs, suggest that ec e further address IRF7-dependent gene expression in IRF7 homodimers dominate in transcribing a m b e a different model system, we used primary MEFs significant portion of the “ISG transcriptome”. To r 2 7 from Irf7-/-, Irf3-/-, and Irf3-/-Irf7-/- mice. As ensure that this binding activity, produced by the , 2 0 previously described (52), activation of ectopic expression of IRF7, was reflective of 18 endogenous IRF3 or IRF7 in Irf7-/- or Irf3-/- endogenous activity, we analyzed IFN-treated primary MEFs, respectively, leads to induction of cells, stimulated with poly(I:C) to ascertain IFNβ, whereas Irf3-/-Irf7-/- primary MEFs are binding patterns of the IRFs versus that of ISGF3 incapable of IFNβ production (figure 5C). (supplemental figure 6A). For this analysis we Furthermore, only Irf3-/-, but not Irf7-/- or Irf3-/-Irf7- incubated extracts with the CXCL10-ISRE and /- primary MEFs express high levels of CXCL10 identified a single inducible factor which could and MAP3K8 upon poly(I:C) stimulation (figure only be supershifted by an IRF7 antibody 5C). This gene induction is not due to (supplemental figure 6B). Taken together, this autocrine/paracrine IFN-I signaling, as primary endogenous IRF7-specific binding, validates the MEFs were additional treated with cycloheximide model derived from ectopic expression and the to inhibit translation. Taken together, these results data conferred from virus infected lung tissue. demonstrate that the IRFs are capable of inducing a broad array of genes that demonstrate significant DISCUSSION overlap with ISGs as well as including a unique The type I IFN system is an essential component subset of gene products. for inhibiting virus replication. It relies on the recognition of the pathogen leading to downstream 7 signaling events and secretion of IFNβ. IFNβ in specificity, or simply encode multiple ISREs in a turn induces the assembly and activation of ISGF3 single promoter (10,38,54-56). Taken together the in an autocrine and paracrine manner, which detailed definition of sequence requirements for upregulates a set of antiviral ISGs, thereby transcriptional activity of IRF3, IRF7, and ISGF3 conferring an antiviral state to a cell. In addition should allow computational prediction based on to this, so-called viral stress-inducible genes the levels of these three factors. (VSIG) are directly induced by PAMPs in the As IRF3 and ISGF3 are found ubiquitously, it infected cell and do not depend on IFNβ signaling. follows that the level of IRF7 is an important The transcription factors suggested to be factor in determining a cell’s transcriptional responsible for induction of VSIGs are nuclear response to virus infection. In fact, IRF7 has factor of kappa light polypeptide gene enhancer in already been termed the “master regulator” for its B-cells (NFκB), activator protein 1 (AP1) and essential role in the induction of IFN-I (52). This IRF3/IRF7 (53). Here we delineate the body of work supports this finding but extends transcriptional profiles of ISGs and VSIGs through IRF7 function beyond the simple induction of a in vitro biochemistry and in vivo validation. single gene product. As IRF7 is undetectable in The enhancer elements responsible for the most non-lymphoid cells, initial induction of IFNβ transcriptional induction of ISGs and VSIGs are is likely the result of two sets of IRF3 dimers D often referred to simply as ISREs. However, no assembled within the context of the enhanceosome o w n distinction is presently made between an ISRE that (15). As the ISREs of the IFNβ enhancer (termed lo a binds to IRFs, ISGF3, or both factors. Here we positive regulatory domains (PRD) I and III) are de d have defined the in vitro biochemical and in vivo imperfect, dependence on IRF3 alone results in fro m transcriptional requirements of a universal ISRE stochastic gene expression in a very small subset h versus an ISGF3- or IF7-specific ISRE. We found of cells (36,37). Low levels of IFNβ, as well as ttp that the DNA binding properties of ISGF3 and additional virus-induced cytokines, prime ://ww w IRF7 both demonstrate some levels of plasticity. neighboring cells to induce IRF7 and subsequent .jb For the IRF7-dimer, a perfect consensus sequence viral spread results in greater induction of IFNβ c.o for one subunit (AAWNCGAAA) is sufficient for mediated by IRF3/IRF7 heterodimers (21). It is brg/ y both binding and transcriptional induction, but also the elevated basal expression of IRF7 that g u mismatches in this region can be compensated for permits pDCs to secrete high levels of IFNβ in es t o by AT base pairing in the neighboring upstream vivo (52). Here we demonstrate that, in addition to n D minor groove. In a similar manner non-canonical IFNβ secretion, pDCs and primed non-lymphoid ec e ISREs mismatched at almost any position by a cells would also be inherently more resistant to m b e single base, demonstrate ISGF3-binding, virus infection. The presence of IRF7, whether r 2 7 presumably due to additional DNA:STAT1/2 basal or the result of priming, would confer an , 2 0 contacts upstream of the core motif. In contrast, ISGF3-like transcriptome onto the cells, thereby 18 the IRF3-dimer demonstrates a more restricted establishing a less permissive environment for DNA binding specificity, as it demands viral replication with shorter kinetics. With this in conservation for both of its ISRE half sites mind, it is perplexing why IRF7 expression does (28,30). This difference is probably due to an not mimic that of IRF3 as this would no doubt extended loop in the DNA-binding domain of confer greater overall cellular resistance to viral IRF7 but not IRF3, providing more flexibility to infection. Perhaps the expression of IRF7 is engage in additional protein-protein interactions confined to a subset of cells to prevent and direct contacts with the DNA (15). In unnecessary IFN-I secretion and induction of the agreement with the sequence requirements, we antiviral state by demanding a certain level of viral show that the transcriptional response to virus replication before being induced. Given our infection is defined by the ISREs encoded constant environmental exposure to viruses that upstream of target genes. These include motifs pose no threat, constitutive IRF7 would result in that permit binding of IRF3, IRF7, and ISGF3, an unnecessary transcriptional response ultimately IRF7 and ISGF3, demonstrate transcription factor resulting in systematic toxicity. 8 REFERENCES 1. Pestka, S., Krause, C. D., and Walter, M. R. (2004) Immunol Rev 202, 8-32 2. Garcia-Sastre, A., and Biron, C. A. (2006) Science 312, 879-882 3. Haller, O., Kochs, G., and Weber, F. (2007) Cytokine Growth Factor Rev 18, 425-433 4. O'Shea, J. J., Gadina, M., and Schreiber, R. D. (2002) Cell 109 Suppl, S121-131 5. Darnell, J. E., Jr., Kerr, I. M., and Stark, G. R. (1994) Science 264, 1415-1421 6. Zhou, Z., Hamming, O. J., Ank, N., Paludan, S. R., Nielsen, A. L., and Hartmann, R. (2007) J Virol 81, 7749-7758 7. Dumoutier, L., Tounsi, A., Michiels, T., Sommereyns, C., Kotenko, S. V., and Renauld, J. C. (2004) J Biol Chem 279, 32269-32274 8. Reich, N., Evans, B., Levy, D., Fahey, D., Knight, E., Jr., and Darnell, J. E., Jr. (1987) Proc Natl Acad Sci U S A 84, 6394-6398 9. Shirayoshi, Y., Burke, P. A., Appella, E., and Ozato, K. (1988) Proc Natl Acad Sci U S A 85, 5884-5888 D o w 10. Rutherford, M. N., Hannigan, G. E., and Williams, B. R. (1988) EMBO J 7, 751- n lo 759 ad e d 11. Kessler, D. S., Levy, D. E., and Darnell, J. E., Jr. (1988) Proc Natl Acad Sci U S fro m A 85, 8521-8525 h 12. Cohen, B., Peretz, D., Vaiman, D., Benech, P., and Chebath, J. (1988) EMBO J ttp ://w 7, 1411-1419 w w 13. tenOever, B. R., Ng, S. L., Chua, M. A., McWhirter, S. M., Garcia-Sastre, A., and .jb c Maniatis, T. (2007) Science 315, 1274-1278 .o rg 14. Fujii, Y., Shimizu, T., Kusumoto, M., Kyogoku, Y., Taniguchi, T., and Hakoshima, b/ y g T. (1999) EMBO J 18, 5028-5041 u e s 15. Escalante, C. R., Nistal-Villan, E., Shen, L., Garcia-Sastre, A., and Aggarwal, A. t o n K. (2007) Mol Cell 26, 703-716 D e c 16. Seeman, N. C., Rosenberg, J. M., and Rich, A. (1976) Proc Natl Acad Sci U S A em b 73, 804-808 er 2 7 17. Brierley, M. M., and Fish, E. N. (2005) J Biol Chem 280, 13029-13036 , 2 0 18. Chen, X., Vinkemeier, U., Zhao, Y., Jeruzalmi, D., Darnell, J. E., Jr., and Kuriyan, 18 J. (1998) Cell 93, 827-839 19. Tanaka, N., Kawakami, T., and Taniguchi, T. (1993) Mol Cell Biol 13, 4531-4538 20. Paun, A., and Pitha, P. M. (2007) Biochimie 89, 744-753 21. Panne, D., Maniatis, T., and Harrison, S. C. (2007) Cell 129, 1111-1123 22. Panne, D., Maniatis, T., and Harrison, S. C. (2004) EMBO J 23, 4384-4393 23. Veals, S. A., Santa Maria, T., and Levy, D. E. (1993) Mol Cell Biol 13, 196-206 24. Escalante, C. R., Yie, J., Thanos, D., and Aggarwal, A. K. (1998) Nature 391, 103-106 25. Sato, M., Hata, N., Asagiri, M., Nakaya, T., Taniguchi, T., and Tanaka, N. (1998) FEBS Lett 441, 106-110 26. Marie, I., Durbin, J. E., and Levy, D. E. (1998) EMBO J 17, 6660-6669 27. Taniguchi, T., Ogasawara, K., Takaoka, A., and Tanaka, N. (2001) Annu Rev Immunol 19, 623-655 9 28. Morin, P., Braganca, J., Bandu, M. T., Lin, R., Hiscott, J., Doly, J., and Civas, A. (2002) J Mol Biol 316, 1009-1022 29. Driggers, P. H., Ennist, D. L., Gleason, S. L., Mak, W. H., Marks, M. S., Levi, B. Z., Flanagan, J. R., Appella, E., and Ozato, K. (1990) Proc Natl Acad Sci U S A 87, 3743-3747 30. Lin, R., Genin, P., Mamane, Y., and Hiscott, J. (2000) Mol Cell Biol 20, 6342- 6353 31. Sato, M., Suemori, H., Hata, N., Asagiri, M., Ogasawara, K., Nakao, K., Nakaya, T., Katsuki, M., Noguchi, S., Tanaka, N., and Taniguchi, T. (2000) Immunity 13, 539-548 32. Baum, A., and Garcia-Sastre, A. Amino Acids 38, 1283-1299 33. Sharma, S., tenOever, B. R., Grandvaux, N., Zhou, G. P., Lin, R., and Hiscott, J. (2003) Science 300, 1148-1151 34. Au, W. C., Moore, P. A., Lowther, W., Juang, Y. T., and Pitha, P. M. (1995) Proc Natl Acad Sci U S A 92, 11657-11661 35. Izaguirre, A., Barnes, B. J., Amrute, S., Yeow, W. S., Megjugorac, N., Dai, J., Feng, D., Chung, E., Pitha, P. M., and Fitzgerald-Bocarsly, P. (2003) J Leukoc Biol 74, D o 1125-1138 w n lo 36. Lu, R., Au, W. C., Yeow, W. S., Hageman, N., and Pitha, P. M. (2000) J Biol a d e Chem 275, 31805-31812 d fro 37. Lu, R., Moore, P. A., and Pitha, P. M. (2002) J Biol Chem 277, 16592-16598 m h 38. Wang, N., Dong, Q., Li, J., Jangra, R. K., Fan, M., Brasier, A. R., Lemon, S. M., ttp Pfeffer, L. M., and Li, K. J Biol Chem 285, 6080-6090 ://w w w 39. Peters, K. L., Smith, H. L., Stark, G. R., and Sen, G. C. (2002) Proc Natl Acad .jb c Sci U S A 99, 6322-6327 .o rg 40. Grandvaux, N., Servant, M. J., tenOever, B., Sen, G. C., Balachandran, S., b/ y Barber, G. N., Lin, R., and Hiscott, J. (2002) J Virol 76, 5532-5539 g u e s 41. Andersen, J., VanScoy, S., Cheng, T. F., Gomez, D., and Reich, N. C. (2008) t o n Genes Immun 9, 168-175 D e c 42. Barnes, B. J., Richards, J., Mancl, M., Hanash, S., Beretta, L., and Pitha, P. M. e m b (2004) J Biol Chem 279, 45194-45207 e r 2 43. Mordstein, M., Kochs, G., Dumoutier, L., Renauld, J. C., Paludan, S. R., Klucher, 7, 2 0 K., and Staeheli, P. (2008) PLoS Pathog 4, e1000151 1 8 44. Kochs, G., Koerner, I., Thiel, L., Kothlow, S., Kaspers, B., Ruggli, N., Summerfield, A., Pavlovic, J., Stech, J., and Staeheli, P. (2007) J Gen Virol 88, 1403- 1409 45. Donelan, N. R., Basler, C. F., and Garcia-Sastre, A. (2003) J Virol 77, 13257- 13266 46. McKendry, R., John, J., Flavell, D., Muller, M., Kerr, I. M., and Stark, G. R. (1991) Proc Natl Acad Sci U S A 88, 11455-11459 47. Niwa, H., Yamamura, K., and Miyazaki, J. (1991) Gene 108, 193-199 48. Evans, M. J., von Hahn, T., Tscherne, D. M., Syder, A. J., Panis, M., Wolk, B., Hatziioannou, T., McKeating, J. A., Bieniasz, P. D., and Rice, C. M. (2007) Nature 446, 801-805 49. Perez, J. T., Varble, A., Sachidanandam, R., Zlatev, I., Manoharan, M., Garcia- Sastre, A., and tenOever, B. R. Proc Natl Acad Sci U S A 107, 11525-11530 10