Logout succeed
Logout succeed. See you again!

1 Mechanistic Assessment of DNA Ligase as an Antibacterial Target in Staphylococcus 1 aureus 2 ... PDF
Preview 1 Mechanistic Assessment of DNA Ligase as an Antibacterial Target in Staphylococcus 1 aureus 2 ...
AAC Accepts, published online ahead of print on 14 May 2012 Antimicrob. Agents Chemother. doi:10.1128/AAC.00215-12 Copyright © 2012, American Society for Microbiology. All Rights Reserved. 1 Mechanistic Assessment of DNA Ligase as an Antibacterial Target in Staphylococcus 2 aureus 3 4 Steven D. Podos, Jane A. Thanassi, and Michael J. Pucci* 5 Achillion Pharmaceuticals, New Haven, CT 06511 D o 6 w n 7 lo a d e 8 Running title: DNA Ligase as an antibacterial target d f r o 9 m h 10 *Corresponding author tt p : / / 11 Mailing address: a a c . 12 Achillion Pharmaceuticals a s m 13 300 George Street .o r g / 14 New Haven, CT 06511 o n A 15 Phone: (203) 624-7000 p r 16 Fax: (203) 624-7003 il 9 , 2 17 E-mail: [email protected] 0 1 9 18 b y g 19 u e s t 1 20 ABSTRACT 21 We report the use of a known pyridochromanone inhibitor with antibacterial activity to 22 assess the validity of NAD+-dependent DNA ligase (LigA) as an antibacterial target in 23 Staphylococcus aureus. Potent inhibition of purified LigA was demonstrated in a DNA 24 ligation assay (K = 4.0 nM) and in a DNA-independent enzyme adenylation assay using i D o 25 full-length LigA (IC = 28 nM) or its isolated adenylation domain (IC = 36 nM). 50 50 w n 26 Antistaphylococcal activity was confirmed against MSSA and MRSA strains (MIC = lo a d e 27 1.0 μg/ml). Analysis of spontaneous resistance potential revealed a high frequency d f r 28 emergence (4×10-7) of high level resistant mutants (MIC > 64) with associated ligA om h 29 lesions. There were no observable effects on growth rate in these mutants. Of 22 tt p : / / 30 sequenced clones, three encoded point substitutions within the catalytic adenylation a a c . 31 domain and 19 in the downstream OB-fold and helix-hairpin-helix (HhH) domains. In a s m 32 vitro characterization of the enzymatic properties of four selected mutants revealed .o r g / 33 distinct signatures underlying their resistance to inhibition. The infrequent adenylation o n A 34 domain mutations altered the kinetics of adenylation and likely elicited resistance p r 35 directly. In contrast, the highly represented OB-fold domain mutations demonstrated a il 9 , 2 36 generalized resistance mechanism in which covalent LigA activation proceeds normally 0 1 9 37 yet the parameters of downstream ligation steps are altered. A resulting decrease in b y g 38 substrate K and a consequent increase in substrate occupancy renders LigA resistant to u m e s t 39 competitive inhibition. We conclude that the observed tolerance of staphylococcal cells 40 to such hypomorphic mutations likely invalidates LigA as a viable target for 41 antistaphylococcal chemotherapy. 42 2 43 INTRODUCTION 44 NAD+-dependent DNA ligase (LigA) has been identified by numerous authors as 45 an attractive potential target for broad-spectrum antibacterial chemotherapy (7, 24). 46 LigA is well conserved among eubacterial species, is architecturally and biochemically 47 distinct from the ATP-dependent DNA ligases of eukaryotic cells, and has been found to D o w 48 be essential for bacterial viability wherever examined (13, 14, 15, 17, 32). Moreover, the n lo a 49 DNA ligation reaction has been dissected mechanistically, mutationally, and structurally d e d 50 (8, 20, 26, 27, 34, 35, 36), and screening assays have been reported for the complete f r o m 51 reaction cycle and for individual component steps (2, 11, 18). h t t p : / 52 DNA ligation activities are essential for multiple DNA processes in replication /a a c 53 and repair, including the joining of Okazaki fragments into a continuous strand during .a s m 54 chromosomal DNA replication. Enzymatically, DNA ligation proceeds via three . o r g 55 successive adenylyl transfer steps (Fig. 1) (33): first, DNA-independent covalent / o n 56 adenylation of the catalytic lysine by the NAD+ substrate; second, adenylyl transfer to the A p r 57 free 5’ phosphate at the nicked DNA ligation site; and third, the covalent sealing of the il 9 , 2 58 DNA nick with concomitant AMP release. Biochemical functions of distinct domains in 0 1 9 59 the modular enzyme structure have been assigned to particular reaction steps. The DNA- b y g 60 independent adenylyl transfer activity resides within the amino-terminal adenylation u e s 61 domain, which comprises an amino-terminal Ia region that is specific to NAD+-dependent t 62 DNA ligases and a nucleotidyl transferase (NTase) region that is universal among DNA 63 and RNA ligases. The subsequent coupling of adenylation to DNA ligation depends 64 upon downstream DNA-binding domains which include an oligonucleotide-binding fold 65 (OB-fold) and a helix-hairpin-helix (HhH) domain. Structural studies of the adenylation 3 66 domain have revealed conformational transitions that accompany the adenylation cycle 67 (8), and structural study of the full-length enzyme bound to DNA-adenylate has identified 68 specific contacts between the DNA-binding domains and the DNA duplex substrate near 69 the nicked ligation site (20). 70 Numerous LigA inhibitors have been reported to date including arylamino acids D o w 71 such as chloroquine (3); glycosyl ureides and glycosylamines (28, 29); tetracyclic indoles n lo a 72 (30); a pyrimidopyrimidine inhibitor (17); substituted adenosine analogs (19, 31); and the d e d 73 pyridochromanones (1). Pyridochromanones were identified by high-throughput f r o m 74 screening as potent competitive inhibitors of DNA ligation by LigA from Staphylococcus h t t p 75 aureus (IC50 ≤ 0.9 μM) (1). They inhibit LigA from diverse bacteria but are inactive :/ / a a 76 against the ATP-dependent human DNA ligase I (1, 9). Moreover they show c . a s 77 antibacterial activity against S. aureus (MIC ≤ 1 μg/ml), with a bactericidal mode of m . o 78 action; their antibacterial activity in S. aureus has been mapped by a putative resistance rg / o 79 lesion to the ligA locus. n A p r 80 In this study we applied the antibacterial activity of a pyridochromanone inhibitor il 9 , 2 81 to assess LigA as an antibacterial target in S. aureus. We report the recovery of 0 1 9 82 numerous high-level resistance mutations dispersed across the ligA gene, with an b y g 83 unexpected concentration of mutations in the OB-fold domain. We examined the kinetic u e s 84 parameters of several mutant LigA isoforms and report a generalized resistance t 85 mechanism in which LigA resistance to competitive inhibitors is achieved via systematic 86 alteration of its kinetic properties. The facility of this mechanism, coupled with the 87 tolerance of the bacteria to broad changes in LigA properties, suggests that LigA makes a 88 poor antibacterial drug target despite its favorable features. Assessment of this potential 4 89 antibacterial target therefore requires greater subtlety than afforded by standard validation 90 criteria. D o w n lo a d e d f r o m h t t p : / / a a c . a s m . o r g / o n A p r il 9 , 2 0 1 9 b y g u e s t 5 91 MATERIALS AND METHODS 92 Bacterial strains and compounds. S. aureus ATCC 29213 (methicillin- 93 sensitive; MSSA), S. aureus ATCC 700699 (methicillin-resistant; MRSA), and E. coli 94 ATCC 25922 were obtained from the American Type Culture Collection, Manassas, VA. 95 Pyridochromanone compounds 1 and 2 were synthesized at Achillion Pharmaceuticals. D o w 96 Adenosine 3′, 5′-cyclic monophosphorothioate (Sp-cAMPs) was purchased from Sigma- n lo a 97 Aldrich, St. Louis, MO. d e d f r 98 Culture conditions. S. aureus strains were grown with aeration at 35°C-37°C in o m h 99 Mueller Hinton II (MH II) broth (Becton Dickinson, Sparks, MD). t t p : / / a 100 Compound susceptibility assays. MICs were determined by broth microdilution a c . a 101 according to the CLSI approved guidelines (5). s m . o r g 102 Selection and characterization of resistant mutants. S. aureus ATCC 29213 / o n 103 cultures were grown overnight under non-selective conditions in BHI or MH II liquid A p r 104 media. Spontaneous pyridochromanone-resistant mutants were recovered from these il 9 , 105 cultures by plating ~1 x 109 organisms followed by overnight growth at 37° C on BHI or 2 0 1 9 106 MH II agar containing 4 μg/ml compound 1. Recovered clones were assessed for b y 107 compound susceptibility and ligA genotype. Genomic ligA DNA was amplified by PCR g u e s 108 using the primers SaLig-N (ATATACCATGGCTGATTTATCGTCTCGTG, NcoI t 109 restriction site underlined) and SaLig-C 110 (TTATATAAGCGGCCGCACTATTTAATTCATTTTGCTTATCTACA, NotI 111 restriction site underlined). Genomic ligA products were purified by QIAquick PCR 112 Purification (QIAgen, Valencia, CA) and their coding sequences determined by 6 113 automated DNA sequencing (W.M. Keck Foundation, Yale University, New Haven, CT, 114 and SeqWright, Houston, TX). 115 LigA protein expression and purification. ligA was amplified by PCR from S. 116 aureus strain N315 with the primers SaLig-N and SaLig-C and the product cloned into 117 the NcoI and NotI sites of the pET21d vector (Novagen) to direct the expression of LigA D o w 118 with a C-terminal His-tag. Missense mutants and the carboxy-terminally tagged LigA n lo a 119 truncation (LigA-Δ comprising residues 1-315) were introduced by QuikChange site- d e d 120 directed mutagenesis according to the manufacturer’s instructions (Stratagene, La Jolla, f r o m 121 CA). All isoforms were expressed in E. coli BL21(DE3)pLysS (Novagen EMD h t t p 122 Biosciences, Madison, WI), purified by HisTrap or HisGraviTrap chromatography (GE : / / a a 123 Healthcare, Piscataway, NJ), and de-adenylated by incubation with excess NMN and c . a s 124 MgCl2 followed by dialysis. m . o r g 125 LigA adenylation assays. 10 nM LigA was incubated with 1 nM [32P-AMP]- / o n 126 NAD+ in buffer A (10 mM HEPES, 25 mM KCl, 20 mM MgCl , 1 mM DTT, 10% PEG A 2 p r 127 8000, pH = 8.0). Reactions were stopped by EDTA after incubation periods ranging il 9 , 2 128 from 7.5 to 60 min, and [32P]-AMP incorporation into LigA was assessed by SDS-PAGE 0 1 9 129 or by a MultiScreen DE or IP filter binding assay (Millipore, Billerica, MA) similar to b y g 130 that of Miesel et al (18) followed by scintillation counting in a Wallac MicroBeta reader u e s 131 (PerkinElmer, Waltham, MA). Reaction rates in the filter-binding assay were converted t 132 from cpm to pM units using the empirically determined specific activity of [32P]-NAD+ 133 substrate. 7 134 DNA ligation assays. The oligonucleotides 1 through 4 were synthesized by IDT 135 (Coralville, IA) as defined by Chen et al (2) with the duplex pairs 1-2 and 3-4 bearing 136 complementary 4 bp overhangs. 1 nM LigA was incubated in buffer A with 10 μM 137 NAD+ and 1.25 ng/μl oligonucleotide duplex DNAs 1-2 and 3-4. Reactions were 138 incubated for 10-12 min (wild-type LigA) or 40 min (mutant LigA) to optimize signal D o 139 while keeping reactions within linear range; reactions were terminated by EDTA w n 140 addition. Ligation was assessed by electrophoresis through 15% polyacrylamide gels lo a d e 141 (Bio-Rad, Hercules, CA) in Tris/boric acid/EDTA buffer followed by SYBR gold d f r o 142 staining (Invitrogen, Carlsbad, CA) and photographic quantitation (Alpha Innotech, San m h 143 Leandro, CA). tt p : / / a a 144 Kinetic analyses. Reactions were conducted in the absence or presence of test c . a s 145 compound. Kinetic parameters were calculated by non-linear regression methods using m . o 146 Prism software (GraphPad, San Diego, CA). Parameters include: Vo for LigA rg / o 147 adenylation reactions as derived from relative reaction rates; K and k for DNA ligation n m cat A p 148 at varying NAD+ concentrations; IC50s for adenylation and ligation reactions in the ril 9 149 presence of inhibitory compound concentration series; and Ki for the ligation reaction , 2 0 1 150 catalyzed by the wild-type enzyme. Ki was also determined for the ligation reaction 9 b y 151 catalyzed by the wild-type enzyme by the Cheng-Prusoff equation Ki = IC50 / (1 + [S] / g u e 152 Km) (3). s t 8 153 RESULTS 154 Inhibition of DNA ligation and LigA adenylation by pyridochromanones. To 155 explore the validity of LigA as an antibacterial target, we examined its susceptibility to 156 two pyridochromanone inhibitors (Fig. 2). We confirmed that these compounds have 157 antibacterial activity against MSSA and MRSA strains of S. aureus (MIC = 1 µg/ml for D o w 158 both strains) but not against E. coli (Table 1). We also confirmed that these compounds n lo a 159 are potent in vitro inhibitors of DNA ligation catalyzed by S. aureus LigA (Table 1), and d e d 160 we determined that these compounds inhibit the DNA-independent auto-adenylation f r o m 161 activity of both full-length LigA and a truncated enzyme LigA(1-315) comprising the h t t p 162 isolated adenylation domain (Table 1). This inhibition of LigA auto-adenylation : / / a a 163 establishes directly the adenylation domain as the locus of pyridochromanone inhibition, c . a s 164 consistent with previous suggestions and our finding (Table 1) that these compounds m . o 165 compete for NAD+ substrate binding. rg / o n 166 Pyridochromanone resistance mutations dispersed throughout ligA. To A p r 167 characterize the mechanism of pyridochromanone action in S. aureus, 22 resistant il 9 , 2 168 derivatives of MSSA strain 29213 were collected from 13 independent cultures following 0 1 9 169 growth on agar plates under selection by compound 1 at 4× MIC (Table 2). Resistant b y g 170 mutants were observed to arise at a frequency of 4×10-7. All recovered mutants showed u e s 171 high-level resistance, as MIC values for compound 1 were elevated > 64-fold above that t 172 of the parental strain (Table 2). All resistant colonies appeared phenotypically normal, 173 and three showed normal doubling times when measured in liquid culture (ACH-0342, 174 ACH-0343, and ACH-0344, not shown). 9 175 Missense point mutations were identified within the ligA gene in all 22 resistant 176 colonies, establishing ligA as the immediate target of compound 1 activity (Table 2). 177 Surprisingly the mutations were dispersed throughout the ligA gene (Fig. 3). Only three 178 were located within the adenylation domain, despite the demonstrated localized activity 179 of compound 1 upon this domain. The remaining 19 were located in the DNA-binding D o 180 OB-fold and HhH domains, with the majority in the OB-fold domain similar to the w n 181 previously reported resistance mutation Ala373 (1). The concentration of lesions in these lo a d e 182 downstream domains suggests a facile resistance pathway whereby mutations in the d f r o 183 DNA-binding domains can overcome pyridochromanone inhibition in the adenylation m h 184 domain, such as by altering the conformational landscape of the enzyme or its interaction tt p : / / 185 with DNA, yet without compromising the essential functions of this enzyme in bacterial a a c . 186 replication. a s m . o 187 Kinetic properties defining three functional classes of LigA mutant. To rg / o 188 dissect the mechanism underlying high-level pyridochromanone resistance, we n A p 189 engineered four of the observed resistance mutations individually into the full-length r il 9 190 LigA enzyme (Fig. 4A). Arg61Ile and Ala303Asp were chosen to represent the relatively , 2 0 1 191 uncommon adenylation domain mutations; Ala349Val and Ala373Thr represented the more 9 b y 192 common OB-fold domain mutations that likely confer pyridochromanone resistance from g u e 193 a distance. All four LigA mutant variants were expressed, purified, and subjected to s t 194 enzymological study. 195 First we examined the NAD+-dependent but DNA-independent LigA adenylation 196 step that pre-activates the enzyme (Fig. 4B, Table 3). LigA is consumed as a substrate 197 during this single-turnover reaction, which therefore is not amenable to classic 10