loading

Logout succeed

Logout succeed. See you again!

ebook img

1 Knockdown of Fanconi anemia genes in human embryonic stem cells reveals early ... PDF

pages43 Pages
release year2010
file size3.71 MB
languageEnglish

Preview 1 Knockdown of Fanconi anemia genes in human embryonic stem cells reveals early ...

From www.bloodjournal.org by guest on January 1, 2019. For personal use only. Blood First Edition Paper, prepublished online January 20, 2010; DOI 10.1182/blood-2009-10-246694 Knockdown of Fanconi anemia genes in human embryonic stem cells reveals early developmental defects in the hematopoietic lineage Asmin Tulpule1,2,3, M. William Lensch1,3,4, Justine D. Miller1,3, Karyn Austin1, Alan D’Andrea5, Thorsten M. Schlaeger1,3, Akiko Shimamura1,6, George Q. Daley1,2,3,4,7,* 1 Division of Pediatric Hematology/Oncology, Children's Hospital Boston and Dana- Farber Cancer Institute, Boston, MA 02115, USA 2 Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, MA 02115, USA 3 Harvard Stem Cell Institute, Boston, MA 02115, USA 4 Howard Hughes Medical Institute, Boston, Massachusetts 02115, USA 5 Department of Radiation Oncology, Dana-Farber Cancer Institute, Harvard Medical School, 44 Binney Street, Boston, MA 02115, USA 6 Department of Pediatric Hematology/Oncology, University of Washington/ Children’s Hospital and Regional Medical Center, Seattle, Washington, USA 7 Division of Hematology, Brigham and Women's Hospital, Boston, MA 02115, USA * Correspondence: [email protected] Running Title: A human embryonic stem cell model of Fanconi anemia 1 Copyright © 2010 American Society of Hematology From www.bloodjournal.org by guest on January 1, 2019. For personal use only. Abstract Fanconi anemia (FA) is a genetically heterogeneous, autosomal recessive disorder characterized by pediatric bone marrow failure and congenital anomalies. The effect of FA gene deficiency on hematopoietic development in utero remains poorly described as mouse models of FA do not develop hematopoietic failure and such studies cannot be performed on patients. We have created a human-specific in vitro system to study early hematopoietic development in FA using a lentiviral RNAi strategy in human embryonic stem cells (hESCs). We show that knockdown of FANCA and FANCD2 in hESCs leads to a reduction in hematopoietic fates and progenitor numbers that can be rescued by FA gene complementation. Our data indicates that hematopoiesis is impaired in FA from the earliest stages of development, suggesting that deficiencies in embryonic hematopoiesis may underlie the progression to bone marrow failure in FA. This work illustrates how hESCs can provide unique insights into human development and further our understanding of genetic disease. 2 From www.bloodjournal.org by guest on January 1, 2019. For personal use only. Introduction Fanconi anemia (FA) is a complex autosomal recessive disorder characterized by marrow aplasia, congenital abnormalities, and a predisposition to malignancy. The major source of mortality in FA is complications associated with bone marrow failure 1. The median age of onset for pancytopenia in FA is 7 years, with thrombocytopenia and anemia generally preceding neutropenia 2. Blood counts at birth are typically normal, though there is evidence that patient marrow is hypoplastic and deficient in CD34+ hematopoietic progenitors well before hematologic complications arise 3, 4. In addition, FA patients have an approximately 15,000-fold increased risk of developing acute myelogenous leukemia (AML) compared to the normal population, as well as an elevated risk for other solid tumors, most notably squamous cell cancers of the head and neck2. Finally, a spectrum of associated dysmorphologies is frequently found at birth including skeletal abnormalities such as radial ray defects and scoliosis, abnormal skin pigmentation, and aberrant kidney and urinary tract development 5. FA demonstrates genetic heterogeneity; bi-allelic mutations in any one of at least thirteen different genes leads to the same condition. Patients with mutations in the same gene comprise members of the same complementation group, reflecting the initial gene identification strategies using cell-fusion techniques (genetic complementation) 1. The genes for the thirteen known complementation groups have been cloned and all appear to function in a common pathway regulating DNA repair. The key diagnostic criterion for FA is hypersensitivity to DNA cross-linking agents, such as mitomycin C (MMC), suggesting that FA cells fail to appropriately sense and/or resolve interstrand cross-links 6. Eight of the FA proteins (FANCA, B, C, E, F, G, L, M) form a nuclear complex that 3 From www.bloodjournal.org by guest on January 1, 2019. For personal use only. functions as an E3 ubiquitin ligase for the FANCI-FANCD2 (ID) heterodimer 7. Upon monoubiquitination, the ID heterodimer is targeted to nuclear foci that contain BRCA1, RAD51, and BRCA2/FANCD1, where it is thought to participate in homology directed DNA repair 8. In addition, FANCD2, FANCI, and FANCD1, components of the pathway that act “downstream” from the core complex, appear to function within a broader set of interactions aimed at maintaining genomic integrity, intersecting with a number of pathways that are mutated in other chromosome instability syndromes including Ataxia- Telangiectasia, Nijmegen breakage syndrome, and Bloom’s syndrome1. Though the disease is similar clinically amongst complementation groups, recent studies have suggested that patients in rare complementation groups that are downstream of the core complex such as FA-D2 (3-6% of all cases) and FA-D1 (<1%) have more severe disease than patients with more common mutations in the core complex components such as FA-A (65% of all cases) 9, 10, perhaps reflecting intrinsic developmental differences between complementation groups. Though there has been extensive biochemical characterization of the FA pathway and its role in maintaining genomic integrity, the connection between cellular deficiencies in DNA repair and the specific clinical phenotypes of marrow aplasia and skeletal malformation remains poorly understood. Previous studies have described DNA-damage induced apoptosis and aberrant cellular signaling, especially in the STAT1 pathway, as possible mechanisms of hematopoietic cell loss in FA 11, 12, though their importance to the pathophysiology of marrow failure in patients remains uncertain. Classically, patients with FA have normal blood counts at birth, but subsequently undergo progressive loss of hematopoietic progenitors and stem cells, resulting in a 4 From www.bloodjournal.org by guest on January 1, 2019. For personal use only. median age at presentation of 7 years 2, 4, 13. Neonatal aplastic anemia in FA has been described 14, 15, though hematopoietic dysfunction may not be recognized in childhood due to the significant compensatory mechanisms present in the bone marrow. The observation that marrow hypocellularity often precedes discrete clinical symptoms coupled with the presence of developmental abnormalities at birth has led to speculation that the FA pathway may have an important role during embryonic development, especially within the hematopoietic system 4, 16. Studies of the developmental aspects of FA have been lacking due to the absence of hematopoietic dysfunction in mouse models of the disease. Individual gene knockouts of Fanca, Fancc, Fancg, and Fancd2 have been generated, and while all knockout mice display an increased sensitivity to DNA cross-linking agents, none develop marrow hypoplasia, bone marrow failure, leukemia, or skeletal abnormalities (reviewed in 17). Subtle hematopoietic differences do exist; notably, decreased long- term repopulating activity 18 and hypersensitivity to oxidative stress 19 and inhibitory cytokines such as interferon gamma 20. However, the absence of marrow aplasia, the central pathology of the human disease, strongly suggests that knockout mouse models are inadequate for the study of hematopoietic failure in FA. Direct analysis of bone marrow from FA patients is restricted by the limited proliferative potential of primary hematopoietic cells, as well as the specific problem of obtaining tissue samples from aplastic FA marrow. Limited studies with human FA hematopoietic progenitors have described a similar hypersensitivity to inhibitory cytokines and reactive oxygen species 11, 21, suggesting that cellular stress induced apoptosis may play an important role in the development of marrow aplasia in FA 13. 5 From www.bloodjournal.org by guest on January 1, 2019. For personal use only. However, studies of FA patient marrow are incapable of addressing the effect of FA gene deficiency on the genesis of hematopoietic tissue that occurs during embryonic development. Since such developmental studies cannot be performed in humans for practical and ethical reasons, the effect of FA gene deficiency on early hematopoietic development remains uncharacterized. Human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs) have the potential to serve as a powerful platform for the study of human development and its dysfunction in genetic disease 16. Previous reports have demonstrated that hESC lines carrying mutations for Lesch-Nyhan and Fragile X syndrome phenocopy their respective diseases 22, 23 and reprogramming of somatic cells from patients has enabled the generation of disease-specific iPSCs 24. Directed differentiation of hESCs/iPSCs into specific tissues from any of the three embryonic germ layers through manipulation of culture conditions and/or genetic modification enables detailed study of the cell fate decisions that occur during development. While hematopoietic differentiation from iPSCs remains to be fully characterized, many groups have reported embryoid body (EB) or stromal co-culture differentiation schemes from hESCs that generate CD45+ hematopoietic cells containing mature myeloid and lymphoid elements, erythromyeloid progenitors with methylcellulose colony forming activity, and low numbers of repopulating cells displaying limited chimerism upon transplantation into immunodeficient mice 25-27. In vitro hematopoietic differentiation from hESCs recapitulates many important aspects of early embryonic hematopoietic development, including specification from a Brachyury positive mesodermal progenitor 28, the presence of a bipotential hemangioblast 29, and temporal globin switching from 6 From www.bloodjournal.org by guest on January 1, 2019. For personal use only. embryonic to fetal hemoglobins reflecting the transition from extra-embryonic to intra- embryonic hematopoiesis 30. Thus, hESCs provide a scalable in vitro model for obtaining unique and valuable insight into early human hematopoietic development. Recently, the Izpisúa-Belmonte group reported that FA patient fibroblasts could not be reprogrammed to FA iPSCs in the absence of genetic complementation 31, which only serves to highlight the need for alternate methods to study early hematopoietic development in FA. We have adopted a lentiviral RNA interference (RNAi) strategy in hESCs to test whether embryonic hematopoiesis is dysfunctional in FA. In this report, we knock down two FA genes: FANCA, the most commonly mutated gene in FA, and FANCD2, a gene mutated in a rare complementation group. We chose FANCA as a representative member of the FA core complex and FANCD2 for its role as a central downstream actor in the FA pathway 8. After generation of stable knockdown hESC lines (referred to as FANCAi and FANCD2i respectively), we demonstrate that FANCAi and FANCD2i hESCs display the characteristic DNA repair defects found in FA. Using directed in vitro differentiation to model embryonic hematopoietic development, we then show that FANCD2i hESCs demonstrate significant reductions in hematopoietic gene expression and progenitor numbers upon differentiation, while FANCAi hESCs display a milder hematopoietic phenotype with intermediate reductions in hematopoietic gene expression and progenitor numbers. FA gene complementation of FANCAi and FANCD2i hESCs rescues the hematopoietic phenotype, substantiating that the observed hematopoietic deficits are specifically related to the FA gene knockdowns. These results establish that not only are the earliest stages of hematopoietic development impaired in FA, but that suggested differences in the severity of disease 7 From www.bloodjournal.org by guest on January 1, 2019. For personal use only. between complementation groups may have a developmental basis. Our work demonstrates the value of hESCs in enabling novel studies of early hematopoietic development in FA and has implications for our understanding of the pathogenesis of bone marrow failure in FA patients. Materials/Methods hESC Cell Culture and Maintenance hESC lines H9 and BGO1 were maintained as undifferentiated cells on inactivated primary mouse embryo fibroblasts (MEFs) (Specialty Media). hESC lines were cultured in 80% knockout Dulbecco modified eagle medium (KO-DMEM) or DMEM: Nutrient Mix F-12 supplemented with 20% knockout serum replacement, 1% non-essential amino acids, 1 mM L-glutamine (all from Invitrogen), 0.1 mM mercaptoethanol (Sigma), and 10 ng/mL human recombinant basic fibroblast growth factor (bFGF) (Invitrogen). hESC lines were passaged weekly by treatment with collagenase IV (Gibco) for 10 minutes followed by cell scraping and mild trituration. siRNA Vector Design Three oligonucleotides encoding stem-loop structures targeting the FANCA and FANCD2 genes were cloned under the control of the human U6 promoter in the pLentilox vector 32. The targeting sequences within FANCA are AAGCTGTCTTCCCTGTTAGAGTT, AAGCATAACATGGAGCTCTTGTT, AAGAAGGCCCTGGTCTTCCTGTT and within FANCD2 are AAGGGAGAAGTCATCGAAGTATT, AAGCAGCTCTCTAGCACCGTATT, 8 From www.bloodjournal.org by guest on January 1, 2019. For personal use only. AAGCTACAGAAGTTGTGCAACTT. A control oligonucleotide targeting the firefly Luciferase gene was directed against GAGCTGTTTCTGAGGAGCC. Lentiviral Vector Production and hESC Transduction Lentiviral vectors, pseudotyped with the vesicular stomatitis virus (VSV) G protein, were produced in 293T cells as described previously 33. hESCs were transduced on Matrigel (BD) in MEF conditioned media by single round infections for 24 hours, followed by expansion onto MEFs and enrichment of infected hESCs by a combination of FACS and manual picking of GFP positive colonies. Both FANCAi and FANCD2i hESC lines were infected with a mixture of three knockdown viruses (each with a different target sequence). Southern Blot analysis Genomic DNA was obtained using the DNAEasy kit (Qiagen). GFP probes were obtained by PCR amplification from pLentilox vector. Probes were labeled and Southern hybridization was performed according to standard protocols. Western Blot Analysis Western blotting analysis was carried out by the use of a monoclonal antibody against FANCD2 (Abcam, 1:500 dilution) followed by a HRP conjugated rabbit anti-mouse secondary antibody (Roche, 1:5000). FANCA western blotting was performed using a polyclonal antibody (Abcam, 1:400) followed by goat anti-rabbit secondary antibody (Roche, 1:5000) 9 From www.bloodjournal.org by guest on January 1, 2019. For personal use only. Teratoma formation and histological analysis Nonobese diabetic/severe combined immunodeficient (NOD/SCID) mice were injected subcutaneously with 1-2 x 106 hESCs resuspended in PBS. Teratomas were excised, paraffin embedded, and analyzed histologically via H&E sections in a blinded fashion for tissues from all three embryonic germ layers. FANCD2 Immunofluorescence hESCs were plated on Matrigel with MEF conditioned media in 6 well plates and treated with 2 mM hydroxyurea (Sigma) for 24 hours. Immunofluorescence staining was performed as described previously 8. The anti-FANCD2 monoclonal antibody (E35 rabbit polyclonal antiserum8 courtesy of Akiko Shimamura and Alan D’Andrea, 1:400 dilution blocking buffer) was added for 2 hours at room temperature, followed by secondary Texas-red anti-mouse antibody (1:400) (Jackson Immunoresearch, West Grove, PA) for two hours in the dark. The cells were visualized with a Zeiss Axioplan 2 microscope (Thornwood, NY), and samples were scored in a blinded fashion for FANCD2 nuclear foci. A threshold of four FANCD2 foci within a cell was required for positivity 34. Chromosomal Breakage Analysis hESC cultures were treated with 200 nM mitomycin C (MMC) for 24 hours in the dark at 37°C. Cultures were then harvested after a 2.5 hour exposure to 30 ng/mL colcemid (Sigma). After a 30-minute treatment with 75 mM KCl, the cells were fixed with a 3:1 10

See more

The list of books you might like